ID: 912744865

View in Genome Browser
Species Human (GRCh38)
Location 1:112237747-112237769
Sequence CTGAGTAATCAGAGGGTAGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
912744865_912744870 -9 Left 912744865 1:112237747-112237769 CCTCCTACCCTCTGATTACTCAG No data
Right 912744870 1:112237761-112237783 ATTACTCAGGCCCCAAACGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
912744865 Original CRISPR CTGAGTAATCAGAGGGTAGG AGG (reversed) Intergenic
No off target data available for this crispr