ID: 912745132

View in Genome Browser
Species Human (GRCh38)
Location 1:112239704-112239726
Sequence AGTGACATGCAGTGGGAAGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
912745127_912745132 0 Left 912745127 1:112239681-112239703 CCTTGAGATGGGGAGTCTGTGGG No data
Right 912745132 1:112239704-112239726 AGTGACATGCAGTGGGAAGGAGG No data
912745122_912745132 23 Left 912745122 1:112239658-112239680 CCTGGTTGCTGATGGCTTTTTAG No data
Right 912745132 1:112239704-112239726 AGTGACATGCAGTGGGAAGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
912745132 Original CRISPR AGTGACATGCAGTGGGAAGG AGG Intergenic
No off target data available for this crispr