ID: 912746959

View in Genome Browser
Species Human (GRCh38)
Location 1:112253013-112253035
Sequence GAGCAGAACTTACTGGAAGG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
912746954_912746959 15 Left 912746954 1:112252975-112252997 CCTACCAAGACGGAAATCAGAGC No data
Right 912746959 1:112253013-112253035 GAGCAGAACTTACTGGAAGGTGG No data
912746955_912746959 11 Left 912746955 1:112252979-112253001 CCAAGACGGAAATCAGAGCAATT No data
Right 912746959 1:112253013-112253035 GAGCAGAACTTACTGGAAGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
912746959 Original CRISPR GAGCAGAACTTACTGGAAGG TGG Intergenic
No off target data available for this crispr