ID: 912747094

View in Genome Browser
Species Human (GRCh38)
Location 1:112253969-112253991
Sequence CCTCAGCTGGTGATGGAGTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
912747094_912747100 6 Left 912747094 1:112253969-112253991 CCTGACTCCATCACCAGCTGAGG No data
Right 912747100 1:112253998-112254020 CTCTTCCCCAGTCCTGTGTCTGG No data
912747094_912747101 7 Left 912747094 1:112253969-112253991 CCTGACTCCATCACCAGCTGAGG No data
Right 912747101 1:112253999-112254021 TCTTCCCCAGTCCTGTGTCTGGG No data
912747094_912747105 13 Left 912747094 1:112253969-112253991 CCTGACTCCATCACCAGCTGAGG No data
Right 912747105 1:112254005-112254027 CCAGTCCTGTGTCTGGGTCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
912747094 Original CRISPR CCTCAGCTGGTGATGGAGTC AGG (reversed) Intergenic
No off target data available for this crispr