ID: 912749124

View in Genome Browser
Species Human (GRCh38)
Location 1:112270868-112270890
Sequence GAAGAGGGACAGCTTGCCCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
912749124_912749131 23 Left 912749124 1:112270868-112270890 CCAGGGGCAAGCTGTCCCTCTTC No data
Right 912749131 1:112270914-112270936 GTCACCTTTGGAGGATGCCATGG No data
912749124_912749129 14 Left 912749124 1:112270868-112270890 CCAGGGGCAAGCTGTCCCTCTTC No data
Right 912749129 1:112270905-112270927 ACCTAATGTGTCACCTTTGGAGG No data
912749124_912749128 11 Left 912749124 1:112270868-112270890 CCAGGGGCAAGCTGTCCCTCTTC No data
Right 912749128 1:112270902-112270924 AGCACCTAATGTGTCACCTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
912749124 Original CRISPR GAAGAGGGACAGCTTGCCCC TGG (reversed) Intergenic
No off target data available for this crispr