ID: 912750861

View in Genome Browser
Species Human (GRCh38)
Location 1:112286224-112286246
Sequence GTGTTTGCATGCACGTGGAG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
912750859_912750861 8 Left 912750859 1:112286193-112286215 CCATAAATGTGCAGTCTGTTATT No data
Right 912750861 1:112286224-112286246 GTGTTTGCATGCACGTGGAGTGG No data
912750858_912750861 13 Left 912750858 1:112286188-112286210 CCATGCCATAAATGTGCAGTCTG No data
Right 912750861 1:112286224-112286246 GTGTTTGCATGCACGTGGAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
912750861 Original CRISPR GTGTTTGCATGCACGTGGAG TGG Intergenic
No off target data available for this crispr