ID: 912753808

View in Genome Browser
Species Human (GRCh38)
Location 1:112307883-112307905
Sequence GCACTTAGTAAGTATTATCT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
912753806_912753808 -7 Left 912753806 1:112307867-112307889 CCTAGGGGAATGATAGGCACTTA No data
Right 912753808 1:112307883-112307905 GCACTTAGTAAGTATTATCTGGG No data
912753799_912753808 20 Left 912753799 1:112307840-112307862 CCATACTCTTTTACATCCTCTGT No data
Right 912753808 1:112307883-112307905 GCACTTAGTAAGTATTATCTGGG No data
912753804_912753808 4 Left 912753804 1:112307856-112307878 CCTCTGTGGTGCCTAGGGGAATG No data
Right 912753808 1:112307883-112307905 GCACTTAGTAAGTATTATCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
912753808 Original CRISPR GCACTTAGTAAGTATTATCT GGG Intergenic
No off target data available for this crispr