ID: 912758556

View in Genome Browser
Species Human (GRCh38)
Location 1:112345887-112345909
Sequence GACTCAGTCACTGTGCTGCG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
912758556_912758561 0 Left 912758556 1:112345887-112345909 CCTCGCAGCACAGTGACTGAGTC No data
Right 912758561 1:112345910-112345932 CCAAGGGTACACAACTAAAGAGG No data
912758556_912758562 6 Left 912758556 1:112345887-112345909 CCTCGCAGCACAGTGACTGAGTC No data
Right 912758562 1:112345916-112345938 GTACACAACTAAAGAGGACAAGG No data
912758556_912758564 19 Left 912758556 1:112345887-112345909 CCTCGCAGCACAGTGACTGAGTC No data
Right 912758564 1:112345929-112345951 GAGGACAAGGTGGAAGTGCATGG No data
912758556_912758563 9 Left 912758556 1:112345887-112345909 CCTCGCAGCACAGTGACTGAGTC No data
Right 912758563 1:112345919-112345941 CACAACTAAAGAGGACAAGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
912758556 Original CRISPR GACTCAGTCACTGTGCTGCG AGG (reversed) Intergenic
No off target data available for this crispr