ID: 912760872

View in Genome Browser
Species Human (GRCh38)
Location 1:112366175-112366197
Sequence TGAGCCACAAACTAACTGCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
912760872_912760874 1 Left 912760872 1:112366175-112366197 CCAGGCAGTTAGTTTGTGGCTCA No data
Right 912760874 1:112366199-112366221 TCTGTGCTTTCCCAGCAACTGGG No data
912760872_912760873 0 Left 912760872 1:112366175-112366197 CCAGGCAGTTAGTTTGTGGCTCA No data
Right 912760873 1:112366198-112366220 GTCTGTGCTTTCCCAGCAACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
912760872 Original CRISPR TGAGCCACAAACTAACTGCC TGG (reversed) Intergenic
No off target data available for this crispr