ID: 912762350

View in Genome Browser
Species Human (GRCh38)
Location 1:112380241-112380263
Sequence TTTCTCTTCCCCAGGTAAGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
912762347_912762350 18 Left 912762347 1:112380200-112380222 CCAGAAGAAGGAAAAGGAAAACT No data
Right 912762350 1:112380241-112380263 TTTCTCTTCCCCAGGTAAGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
912762350 Original CRISPR TTTCTCTTCCCCAGGTAAGC AGG Intergenic
No off target data available for this crispr