ID: 912762479

View in Genome Browser
Species Human (GRCh38)
Location 1:112381507-112381529
Sequence GGTATTTTATCTAGACTGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
912762474_912762479 16 Left 912762474 1:112381468-112381490 CCTGGAGGAAGTGACATCTGAGG No data
Right 912762479 1:112381507-112381529 GGTATTTTATCTAGACTGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
912762479 Original CRISPR GGTATTTTATCTAGACTGGA AGG Intergenic