ID: 912766574

View in Genome Browser
Species Human (GRCh38)
Location 1:112417816-112417838
Sequence TTTTATTTATGGAGTTTTGG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1023
Summary {0: 1, 1: 0, 2: 4, 3: 83, 4: 935}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
912766569_912766574 5 Left 912766569 1:112417788-112417810 CCATAGCATTCTTTAAACTGAAG 0: 1
1: 0
2: 1
3: 19
4: 225
Right 912766574 1:112417816-112417838 TTTTATTTATGGAGTTTTGGGGG 0: 1
1: 0
2: 4
3: 83
4: 935

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
912766574 Original CRISPR TTTTATTTATGGAGTTTTGG GGG Intronic
900670571 1:3851294-3851316 TTTTCCTTTTGGAGTTTTTGAGG - Intronic
901503426 1:9668481-9668503 TTTTATTTCAGTAGTTTTTGGGG + Intronic
902052291 1:13573700-13573722 TTTTTTTTTTGTATTTTTGGTGG + Intergenic
902366429 1:15977497-15977519 TTTTATTTCAGTAGTTTTTGGGG + Intergenic
902459197 1:16559718-16559740 TTTTATTTATTTGTTTTTGGGGG + Intergenic
902591575 1:17478699-17478721 TTTTATTTATTTATTTTTTGAGG + Intergenic
902893254 1:19460588-19460610 TTTTTTTTTTGTATTTTTGGTGG + Intronic
903111993 1:21143660-21143682 TTTTATTTATACACTTTGGGAGG + Intronic
903152391 1:21420400-21420422 TTTTATTTATTTGTTTTTGGGGG + Intergenic
903309843 1:22446212-22446234 TTTTTTTTTTTCAGTTTTGGAGG - Intergenic
903757830 1:25675090-25675112 TTTTATTTCAGTAGTTTTTGGGG + Intronic
903865578 1:26395289-26395311 TTTTATTTATTTATTTTTTGAGG + Intergenic
903949103 1:26984067-26984089 TTTTTTTTTTGCAGTTTTCGTGG - Intergenic
905600288 1:39244281-39244303 TTTTATTTATTTATTTTTTGAGG + Intronic
905654770 1:39678945-39678967 TTTTCTTTCTGGAATTTTCGAGG - Exonic
906024585 1:42662394-42662416 TTTTATTTTTTTATTTTTGGTGG + Intronic
906034550 1:42742093-42742115 TTTGCTTCATGGAGTTGTGGTGG + Intergenic
906070796 1:43015069-43015091 TTTTATTTTAGTAGTTTTTGGGG - Intergenic
906198514 1:43944861-43944883 TTTTAGTTAAGGGGTTTTAGGGG - Intergenic
906592359 1:47038055-47038077 TTTTAATTAAGGAGATTTTGTGG + Intronic
906775405 1:48524965-48524987 TTTTATTTGTGAACTTCTGGAGG + Intergenic
907112606 1:51939913-51939935 TTTCATTGATGGAGTTGTGGTGG - Intronic
907129482 1:52082867-52082889 TGTTCTTTATGGATTTTTAGTGG + Intronic
908164343 1:61443250-61443272 TTTTATCTTTGGAGTTGTTGGGG - Intronic
908446801 1:64206116-64206138 TTTGATTTATGAAAATTTGGGGG - Intronic
908815306 1:68026029-68026051 TCTCATCTATGGATTTTTGGGGG + Intergenic
909111330 1:71481734-71481756 TTTTATTTAAGCATTTTTTGAGG + Intronic
909173619 1:72325832-72325854 TTTTATTTTTGGTTTTTAGGTGG - Intergenic
909304761 1:74060089-74060111 TTTTATTTCTGGAAATTTTGTGG + Intronic
909579076 1:77212333-77212355 TTTTATAGATGGAGATTTGGAGG - Intronic
909737410 1:78980021-78980043 TTTTATTTCAATAGTTTTGGGGG - Intronic
909762048 1:79301818-79301840 TTTTGTTTATGAAGTTTCTGTGG + Intergenic
910122890 1:83809858-83809880 TTTTATTTTGGTAGTTTTGGGGG - Intergenic
910269765 1:85381352-85381374 TTTTATTTCAATAGTTTTGGGGG + Intronic
910570236 1:88692797-88692819 TTTCTTTTATGGAGTTGTGTGGG + Intronic
910766809 1:90790346-90790368 TTTTATTTTTGTAGATTTAGAGG + Intergenic
910923528 1:92374948-92374970 TTTTATTTCAGTGGTTTTGGGGG - Intronic
911233972 1:95390006-95390028 TTCTATTTTTTGATTTTTGGGGG + Intergenic
911569544 1:99506643-99506665 TTTTTTTTTTGGAGGTTGGGGGG - Intergenic
911612860 1:99976069-99976091 TTTTATTTTTGGGGTTTTTTTGG - Intronic
911697051 1:100901331-100901353 TTTTATTTAGGGTCTATTGGAGG - Intronic
912766574 1:112417816-112417838 TTTTATTTATGGAGTTTTGGGGG + Intronic
912800695 1:112718141-112718163 TTTTATTTATTTATTTTTTGGGG - Intergenic
912843091 1:113056529-113056551 TTTTTTTAATAGAGTTTTGTTGG - Intergenic
912852074 1:113135436-113135458 TTTGATGTATTGAATTTTGGAGG - Intergenic
914402543 1:147336756-147336778 ATTGATTTTTGGAGTTATGGGGG - Intergenic
915768634 1:158394017-158394039 TTTTATTTCAGTAGTTTTTGGGG + Intergenic
916434109 1:164760556-164760578 TTTTATTGTTGTTGTTTTGGGGG - Intronic
916751361 1:167725483-167725505 TTTTATTTATTTATTTTTTGGGG + Intronic
917389122 1:174513611-174513633 TTTTATTTATTTATTTTTGGGGG - Intronic
917426181 1:174916935-174916957 ATTTATGTCTGCAGTTTTGGAGG + Intronic
917546546 1:175974957-175974979 TTTGAATTATGCAATTTTGGGGG - Intronic
917663530 1:177201168-177201190 TTTTATTTCAATAGTTTTGGGGG - Intronic
918103030 1:181393072-181393094 TTTTCTTTGTGGAGTGCTGGAGG + Intergenic
918120482 1:181534637-181534659 TTTTATTTCAATAGTTTTGGGGG - Intronic
919182760 1:194106209-194106231 TTATCATTATGGAATTTTGGGGG - Intergenic
919697600 1:200594356-200594378 TTTTTTTTTTGAATTTTTGGGGG - Intronic
920528118 1:206683779-206683801 TCTTCTCTCTGGAGTTTTGGGGG + Intronic
921236907 1:213141443-213141465 TTTTATTTTTTGAATTTTTGTGG + Intronic
921336490 1:214092203-214092225 ATTTATTTCTTAAGTTTTGGAGG - Intergenic
921774719 1:219083547-219083569 TTTTCTTTATAGAGTTATTGAGG + Intergenic
921788319 1:219259766-219259788 TTTTATTTCAATAGTTTTGGGGG - Intergenic
922077364 1:222260059-222260081 TTTTGATTATTGAGTTTTGAGGG - Intergenic
922089474 1:222381995-222382017 TTTTATTTTTAGTGCTTTGGTGG - Intergenic
922324739 1:224517486-224517508 TATTATTTCAGTAGTTTTGGGGG + Intronic
922331224 1:224578150-224578172 TTTTATTTCAATAGTTTTGGGGG - Intronic
922384280 1:225066506-225066528 TTTTATTTCGATAGTTTTGGGGG + Intronic
922431224 1:225555922-225555944 TATTATTAATCGAGTTTTGTAGG + Intronic
922509865 1:226155688-226155710 TTTAATTTATTGACTTTTTGGGG - Intronic
923276229 1:232399363-232399385 TTTTACTTATGTACTTTTTGAGG + Intronic
923596837 1:235367088-235367110 TTTTTTTTTTTTAGTTTTGGCGG + Intergenic
923910924 1:238442784-238442806 TTTTGTTTTTGGATTTTTGACGG - Intergenic
924117311 1:240761188-240761210 TTTTATTTATTTATTTTTTGAGG - Intergenic
924721749 1:246629530-246629552 TCTTATTTGAGGAGTTTTGATGG - Intronic
1062964697 10:1598408-1598430 TTTTATTTCTATAGATTTGGGGG - Intronic
1064070388 10:12223872-12223894 TTTTATTTCAGTAGGTTTGGGGG + Intronic
1064111153 10:12540100-12540122 TTTTTTTTTTGGAGAGTTGGGGG + Intronic
1064406339 10:15067528-15067550 TGTTACTTCTGGTGTTTTGGAGG - Intronic
1064467983 10:15604413-15604435 TTTTATTTAAGGATTTATAGAGG + Intronic
1064764915 10:18660847-18660869 TTTTATTTATTTATTTTTTGAGG + Intronic
1064962751 10:20984069-20984091 TTTTAATAATGAAGTTTTGCAGG + Intronic
1064974313 10:21097457-21097479 TTTTATTTATGTATTTTTTTGGG - Intronic
1065162638 10:22938830-22938852 TTTTATTCATGGTGGTTTGGGGG - Intronic
1065260971 10:23922951-23922973 TTTTATTTTAATAGTTTTGGGGG + Intronic
1065268566 10:24002659-24002681 TTTTATTTTGGTAGTTTTGGGGG + Intronic
1065441231 10:25755611-25755633 TTTTTTTTTTGTATTTTTGGTGG - Intergenic
1065910179 10:30296379-30296401 TTTTATTTCAATAGTTTTGGGGG + Intergenic
1065999747 10:31093126-31093148 TTTTATTTATTTATTTTTGGAGG + Intergenic
1066320163 10:34295035-34295057 TTTTAATTTTTGAGTTTTTGTGG - Intronic
1067330810 10:45317131-45317153 TTTTATTTATGTATTTATTGAGG + Intergenic
1067981094 10:51085532-51085554 TTTTATTTTTGAACTTTTGGAGG + Intronic
1067992256 10:51227993-51228015 TTTTCTTTAGGGATTTTTGGAGG + Intronic
1068585526 10:58793870-58793892 TTTTAGATTTGGGGTTTTGGGGG - Intronic
1068994699 10:63189865-63189887 ATATATATATGGAGTATTGGGGG - Intronic
1069257237 10:66347982-66348004 TTTTATTTATACTGTTTTGGAGG - Intronic
1069273916 10:66566063-66566085 TTTTATTTATTGACTTTCAGTGG + Intronic
1069309464 10:67016387-67016409 TTTTATTTAAGGAGTTTGCATGG + Intronic
1069503097 10:68971959-68971981 TGGTAGTTTTGGAGTTTTGGTGG + Exonic
1069542294 10:69304306-69304328 ATTTATTTATTTATTTTTGGGGG + Intronic
1069947500 10:71998138-71998160 TTTGATTTATTTATTTTTGGGGG - Intronic
1070109840 10:73474602-73474624 TTTTTTTTTTGTATTTTTGGTGG + Intronic
1070435707 10:76390684-76390706 TATTATTTAGGGAATTATGGGGG - Intronic
1071127946 10:82357480-82357502 TTTATTTTTTGCAGTTTTGGAGG + Intronic
1071172006 10:82877551-82877573 TTTTTTTTTTGGATTTTTAGTGG + Intronic
1071386769 10:85129060-85129082 TTTTATTTCTGTAGGATTGGTGG - Intergenic
1071775092 10:88777779-88777801 TTTTATTTTTGGAGTGTTTATGG + Intronic
1071792585 10:88970988-88971010 TTTTATTTATTGCCTTTGGGCGG - Intronic
1071948378 10:90674179-90674201 TTTTATTTCAATAGTTTTGGGGG + Intergenic
1072409543 10:95187280-95187302 GTTTATTCTTAGAGTTTTGGGGG + Intergenic
1072557530 10:96532716-96532738 TTTTATCTATAAAGTTTTGTTGG - Intronic
1072858090 10:98970912-98970934 TTTTATTTAAGGTTTTTAGGGGG - Intronic
1072983601 10:100120301-100120323 TTTCATTTATGTATATTTGGGGG + Intergenic
1073330261 10:102665834-102665856 TTTTATTTATGTATTTTTTTGGG - Intergenic
1073742114 10:106419291-106419313 TTTTATTTCAGTAGTTTTGGGGG - Intergenic
1073745758 10:106466601-106466623 TTTTATTTATTTATTTTGGGAGG - Intergenic
1073877179 10:107938409-107938431 TTTTATTTCAATAGTTTTGGGGG + Intergenic
1073961717 10:108938847-108938869 TTTTATTTATTGGGATTTTGGGG - Intergenic
1073977321 10:109116340-109116362 TTTTATTTTTGCAGAGTTGGGGG + Intergenic
1074152985 10:110774950-110774972 CCTTATTTATGGTATTTTGGTGG - Intronic
1074378710 10:112960855-112960877 TTTTATTTTTGTATTTTTAGTGG + Intronic
1074627266 10:115204177-115204199 TTTTTTTTACAGATTTTTGGTGG + Intronic
1074775985 10:116768672-116768694 TTTTATTTTTGTAGAGTTGGGGG + Intergenic
1074937449 10:118196398-118196420 TTTTAATTATTGAGTTTTGAGGG + Intergenic
1075142264 10:119849564-119849586 TTGAATTTAGGGAGTGTTGGTGG - Exonic
1075287693 10:121201528-121201550 TTTTATTTATTTTATTTTGGTGG - Intergenic
1075852851 10:125603170-125603192 TTTTATTTAAGTAGTTTTATTGG - Intronic
1076550623 10:131275704-131275726 TTTTATTTCAGTAGTTTTTGGGG - Intronic
1076947553 10:133661754-133661776 TTTTCTTTATAGAATTTTGTTGG + Intergenic
1077293141 11:1809525-1809547 TTTGCTTTATTGGGTTTTGGGGG - Intergenic
1078121083 11:8509518-8509540 TTTTATTTCAATAGTTTTGGGGG + Intronic
1078737029 11:14029758-14029780 GTTTAAATATGGAGTTTTGCTGG + Intronic
1078976244 11:16481092-16481114 TTAAATTGATGGAGCTTTGGAGG - Intronic
1079778376 11:24563241-24563263 TTTTATAAATTGTGTTTTGGTGG - Intronic
1079807810 11:24956521-24956543 TTTTATACATGCTGTTTTGGAGG + Intronic
1079816339 11:25063838-25063860 TTGTATTCATGGAATTTTTGTGG - Intronic
1080423347 11:32133051-32133073 TTTTATTTCAATAGTTTTGGGGG + Intergenic
1081213105 11:40360066-40360088 TTTTATTTGTTGAGTTATGGAGG - Intronic
1081461497 11:43276467-43276489 TTTTATTTCAGTAGTTTTGGGGG + Intergenic
1081826605 11:46059894-46059916 TTTTATTTATTTATTTTTGGGGG + Intronic
1081954183 11:47075367-47075389 TTTTATTTATTTATTTTTTGAGG - Intronic
1082103897 11:48198648-48198670 TTTTATTTCAATAGTTTTGGGGG + Intergenic
1082921953 11:58505190-58505212 TTTTATTTCATTAGTTTTGGGGG - Intergenic
1083240196 11:61382198-61382220 TTTTATTTTTAGAGATTGGGGGG - Intergenic
1083537738 11:63486793-63486815 TTTTATTTCAATAGTTTTGGGGG - Intronic
1084184886 11:67466344-67466366 TTTTATTTATTTATTTTTTGAGG - Intronic
1084519190 11:69653092-69653114 TTTTATTTAGGAAGTGTTGAAGG + Exonic
1084540542 11:69783582-69783604 ATTTATTAATTGACTTTTGGGGG + Intergenic
1085341036 11:75731794-75731816 TTTTAGTTTTTAAGTTTTGGTGG - Intronic
1085774590 11:79353834-79353856 GTTTATTTATGTAGTTTTATTGG + Intronic
1085909612 11:80806303-80806325 TTTTATTTTTATAATTTTGGGGG + Intergenic
1086092336 11:83017390-83017412 TTTTATTTAAATAGTTTTTGGGG + Intronic
1086144338 11:83534942-83534964 TTATATTTATTTACTTTTGGGGG - Intronic
1086361475 11:86064899-86064921 TTTTATTTTTGGAGAGATGGGGG - Intronic
1086506532 11:87510249-87510271 TTTTCTTTCTGTAGTTTTAGTGG + Intergenic
1086612037 11:88768952-88768974 TTTTATTCATGGAGGTTTGAAGG - Intronic
1086813490 11:91339730-91339752 TATTATTTATGTGGTATTGGTGG - Intergenic
1086921243 11:92589642-92589664 TTTTCTTGATTGAGTTTCGGTGG + Intronic
1087064456 11:94014355-94014377 TTTTATTTCAACAGTTTTGGGGG - Intergenic
1087109517 11:94448410-94448432 TTTTTTTTTTGTATTTTTGGTGG - Intronic
1087532304 11:99399610-99399632 TTTTTTTTATTAAGTGTTGGTGG + Intronic
1087800084 11:102494216-102494238 TTTTATTTATTTATTTTTTGAGG + Intronic
1088103388 11:106178676-106178698 TTTAATATGTGGGGTTTTGGGGG + Intergenic
1088145319 11:106669805-106669827 TTTTATTTATGTAAATTTAGGGG - Intergenic
1088392885 11:109334832-109334854 TTTTTTTTTTGTAGTTTTAGTGG - Intergenic
1088597309 11:111450086-111450108 TCTTATTCAAGGAGTTTTGTAGG - Intronic
1089045047 11:115493840-115493862 TTTTCTTTAAGGAGTTTTTAAGG - Intronic
1089192625 11:116664623-116664645 TTTTATTTATTTATTTTTTGTGG - Intergenic
1089686797 11:120155378-120155400 TTTTATTTAAATAGCTTTGGGGG - Intronic
1089817574 11:121189985-121190007 CTTAATTTCTGGAGTTTTCGAGG - Intronic
1089888404 11:121854615-121854637 TATTATTTATGGTGTTTTTAGGG - Intergenic
1089985552 11:122809589-122809611 TTTTATTTATCGATTTTTGAAGG + Intronic
1090371491 11:126257190-126257212 ATTTATTCATGGAGTATTTGTGG + Intronic
1090490217 11:127154182-127154204 TTTGATTTAGGGAGTTCTGAGGG + Intergenic
1090729660 11:129558599-129558621 ATTTATTTATTTATTTTTGGTGG - Intergenic
1090986720 11:131773455-131773477 TTTTATTTATGAACTTTCCGTGG + Intronic
1091947222 12:4558085-4558107 TTTTACTTTTGGGGTCTTGGTGG - Intronic
1092038897 12:5366051-5366073 CTTTATTTCAGTAGTTTTGGGGG + Intergenic
1092102426 12:5896251-5896273 TTTTATTTCAATAGTTTTGGTGG - Intronic
1093600491 12:21015427-21015449 TTTTAGTTCATGAGTTTTGGGGG - Intergenic
1094335424 12:29345483-29345505 TTATATGTATGTAGTTTTGTTGG + Exonic
1094587765 12:31793728-31793750 TTTTATTTTTTTATTTTTGGAGG - Intergenic
1094778810 12:33765442-33765464 TTTTATTTCAATAGTTTTGGGGG - Intergenic
1095105891 12:38232738-38232760 TTTTGTTTATGTATTTTTGTGGG + Intergenic
1095509297 12:42932604-42932626 TTTTATCTATTGATTTTTGGGGG + Intergenic
1095858137 12:46884631-46884653 GTTTCTTTCTGGAGGTTTGGGGG + Intergenic
1096372330 12:51079595-51079617 TTTTTTTTTTGGATTTTTAGTGG - Intronic
1096451532 12:51746537-51746559 ATTTATTTATGGATATGTGGGGG - Intronic
1096872648 12:54603481-54603503 TTTTTTTAATGGGGGTTTGGGGG + Intergenic
1096957642 12:55542947-55542969 TTGTATTTCTGTAGTATTGGTGG + Intergenic
1097894300 12:64809108-64809130 TTTTATTTAAATAGTTTTTGGGG + Intronic
1098364940 12:69692761-69692783 TTTTATTTATTTATTTTTTGGGG + Intronic
1098401497 12:70081330-70081352 TTTTATATTTGTAGTTGTGGGGG - Intergenic
1098537748 12:71613881-71613903 TTTTATTTATTTATTTTTGGTGG - Intronic
1098731864 12:74045408-74045430 TTTTATTTAAATAGTTTTGGGGG - Intergenic
1098794226 12:74867763-74867785 TTTTATTTTTGTAGATTTAGGGG + Intergenic
1098965052 12:76778846-76778868 TTTTTTTTCTCCAGTTTTGGAGG + Intronic
1099061935 12:77922300-77922322 TTTAATTTTTGAACTTTTGGAGG + Intronic
1099449244 12:82788995-82789017 TTTTATTTATCTATTTTTTGAGG - Intronic
1099501877 12:83423310-83423332 TTTTATTCTTAGAGTTCTGGAGG - Intergenic
1099705134 12:86142723-86142745 TTTTTTTTGTGGAGGGTTGGGGG + Intronic
1099739923 12:86621083-86621105 TTTTATTTTTGTAGATTTAGAGG - Intronic
1099930549 12:89069271-89069293 TTTTATTTCAATAGTTTTGGGGG + Intergenic
1100255490 12:92879112-92879134 ATTTGTTTATGTATTTTTGGGGG - Intronic
1100298167 12:93282053-93282075 TCTGATTTATAGGGTTTTGGGGG - Intergenic
1100352912 12:93801709-93801731 GTTTATTTAAATAGTTTTGGGGG + Intronic
1100424757 12:94474065-94474087 TTTTGTATCTTGAGTTTTGGAGG + Intergenic
1100553163 12:95666402-95666424 TTTTATTTCAATAGTTTTGGGGG - Intronic
1100740790 12:97589978-97590000 TTTAATCCACGGAGTTTTGGAGG + Intergenic
1100802618 12:98249387-98249409 TTGTATTTGTGGTATTTTGGGGG - Intergenic
1101183219 12:102242938-102242960 TTTTATTTCTGTAGCTTTTGGGG + Intergenic
1101324504 12:103703324-103703346 TTTTTTTTATATAATTTTGGGGG + Intronic
1101591815 12:106131549-106131571 TTTTATTTATGGAATATTTTTGG - Intronic
1102241145 12:111325607-111325629 TTTTGTTTATAGTGTTGTGGTGG + Intronic
1102241154 12:111325641-111325663 TTTTGTTTATAGTGTTGTGGTGG + Intronic
1102241164 12:111325676-111325698 TTTTGTTTATAGTGTTGTGGTGG + Intronic
1102241183 12:111325745-111325767 TTTTGTTTATAGTGTTGTGGTGG + Intronic
1102241223 12:111325882-111325904 TTTTGTTTATAGTGTGTTGGGGG + Intronic
1102241232 12:111325914-111325936 TTTTGTTTATAGTGTGTTGGGGG + Intronic
1102241239 12:111325946-111325968 TTTTGTTTATAGTGTTGTGGTGG + Intronic
1102241261 12:111326016-111326038 TTTTGTTTATAGTGTTGTGGTGG + Intronic
1102241302 12:111326154-111326176 TTTTGTTTATAGTGTTGTGGTGG + Intronic
1102241322 12:111326223-111326245 TTTTGTTTATAGTGTTGTGGTGG + Intronic
1102241340 12:111326293-111326315 TTTTGTTTATAGTGTTGTGGTGG + Intronic
1102241350 12:111326328-111326350 TTTTGTTTATAGTGTTGTGGTGG + Intronic
1102241362 12:111326363-111326385 TTTTGTTTATAGTGTTGTGGGGG + Intronic
1102408523 12:112695847-112695869 TTTTATTTCAGTAGTTTTGAGGG + Intronic
1102720959 12:115015523-115015545 TTTTAGTTATGGAACTTTGGGGG - Intergenic
1103033626 12:117638925-117638947 TGTTGGTCATGGAGTTTTGGGGG - Intronic
1103103519 12:118202411-118202433 TTTTGTTTTTTGGGTTTTGGAGG + Intronic
1103188104 12:118979326-118979348 TTTTAATAATGGCCTTTTGGGGG + Intergenic
1103243573 12:119435747-119435769 TTTAAGTTACTGAGTTTTGGGGG - Intronic
1103254163 12:119526233-119526255 TTTTATTTATGGTGTAAGGGAGG - Intronic
1103954590 12:124568985-124569007 TTTTAATTATGAGCTTTTGGGGG + Intergenic
1104105481 12:125654806-125654828 TTTGATTTGTGGAGGTCTGGTGG + Exonic
1104316169 12:127703877-127703899 TTTTATTTAAAGAGTTTTACTGG - Intergenic
1104396604 12:128439227-128439249 TTTTTTTCATGGTGTTGTGGAGG - Intronic
1104397064 12:128443403-128443425 TTTTATTTCTGTAGCTTTTGGGG - Intronic
1105823920 13:24105297-24105319 TTTTATTTTTTGTATTTTGGGGG + Intronic
1106282896 13:28291827-28291849 TTTTATTTATTTAATTTTTGGGG - Intronic
1106358604 13:29008818-29008840 TTTTTTTTCTAGACTTTTGGTGG + Intronic
1106850952 13:33790870-33790892 TTTTATTTCACTAGTTTTGGGGG - Intergenic
1107003475 13:35579372-35579394 TTTTATTTATATAATTTTTGTGG + Intronic
1107041834 13:35957107-35957129 TTCTATTAATGGTGTTTTGTAGG - Intronic
1107101308 13:36596473-36596495 TTTTAGTTATCCAGGTTTGGTGG - Intergenic
1107510141 13:41075296-41075318 TTTTTATTATGGTGGTTTGGTGG - Intronic
1107526642 13:41239232-41239254 ATTTATTTATCTACTTTTGGAGG - Intronic
1107705672 13:43101423-43101445 TTTTATTTCAGTAGTTTTGGGGG + Intronic
1107723486 13:43274021-43274043 TTTTGTTTTTGTTGTTTTGGTGG - Intronic
1108162873 13:47660884-47660906 TTTTATTTATTAACCTTTGGTGG - Intergenic
1108222806 13:48254579-48254601 TTTTTTTTTAGGAGTTTTGAAGG + Intronic
1108629001 13:52262447-52262469 TTTTCTTTTAGTAGTTTTGGTGG - Intergenic
1108657054 13:52544029-52544051 TTTTCTTTTAGTAGTTTTGGTGG + Intergenic
1108720802 13:53129755-53129777 TTGTTTTTAGGGGGTTTTGGGGG + Intergenic
1109139302 13:58693919-58693941 TTTTTTTTAAGTAGTTTTAGTGG - Intergenic
1109756683 13:66770344-66770366 TTTTATTTTAGCAGTTTTTGGGG - Intronic
1109822558 13:67677241-67677263 TTTTATTTCTGTAGGTTTTGGGG - Intergenic
1109866914 13:68276574-68276596 TTTTCTTTATGTATTTTTAGGGG + Intergenic
1109919386 13:69036293-69036315 TTTTTTTTATGTATTTTTAGTGG + Intergenic
1110539443 13:76691162-76691184 TTTTATTTTGGGATCTTTGGTGG - Intergenic
1110610660 13:77483965-77483987 TTTTATTTATTTATTTTTTGTGG + Intergenic
1110718841 13:78738652-78738674 TTTTATTTTTTGAGTTGGGGGGG - Intergenic
1110899349 13:80800870-80800892 TTTTATTTTTTCAATTTTGGTGG - Intergenic
1110953991 13:81529855-81529877 TTTTTTTTAAGGTGGTTTGGTGG - Intergenic
1111184474 13:84713859-84713881 TTTTATTTCAGTAGTTTTTGGGG + Intergenic
1111259454 13:85717473-85717495 TTTTTTTGTTGGGGTTTTGGGGG - Intergenic
1111314648 13:86537530-86537552 TTTTATATCTGAAGTTTTTGGGG + Intergenic
1111382628 13:87478617-87478639 TTTTATTTATTTATTTTTTGAGG - Intergenic
1111418599 13:87979384-87979406 TTTTATTTATTTATTTTTTGAGG - Intergenic
1111437150 13:88225476-88225498 TTTAATGTATGGAGATTTGATGG - Intergenic
1111593735 13:90384299-90384321 TTTATTTTAGAGAGTTTTGGAGG - Intergenic
1111730235 13:92065825-92065847 TTTTATTAATTGATTTTTGAGGG + Intronic
1111787070 13:92802093-92802115 TATTATTAATGGAGATTTGCAGG - Intronic
1111820080 13:93202993-93203015 TTTTATTTCAATAGTTTTGGGGG + Intergenic
1112041158 13:95549834-95549856 TTTAATTTATGGATTGTTTGTGG + Intronic
1112117944 13:96377973-96377995 TTTTATTTACTGGGTTTTGATGG + Intronic
1112126949 13:96478784-96478806 TTTTACAAATGGAGATTTGGGGG + Intronic
1112383195 13:98912915-98912937 TTTTGTTTCTGGATGTTTGGGGG - Intronic
1112641936 13:101285295-101285317 TATTATTTATTTATTTTTGGGGG + Intronic
1112675305 13:101694592-101694614 TATTTTTTGTGGAGATTTGGGGG + Intronic
1112727397 13:102320251-102320273 TTTTTTTTTTGGAGTTTTCAAGG - Intronic
1112865294 13:103888758-103888780 TTTTATTTATAAAGTGTTGTTGG + Intergenic
1113215483 13:108035855-108035877 TTATATATATGGCCTTTTGGGGG - Intergenic
1113389105 13:109878610-109878632 GTTTATTTATCAAGTTCTGGAGG - Intergenic
1113720207 13:112550226-112550248 ATTTTTTGATGGAGTTTTGCTGG - Intronic
1114289122 14:21273208-21273230 TTTTATTTATTTATTTTTGGGGG + Intergenic
1114675244 14:24435907-24435929 TTTTATTTTTGTAGATTTGGGGG + Intronic
1114989199 14:28265969-28265991 TTTTATTTATTTATTTTTGAAGG - Intergenic
1115108370 14:29789374-29789396 TTTTATGGATGGCTTTTTGGGGG + Intronic
1115554491 14:34533772-34533794 TTTTATTTAATGAGATTTGTGGG - Intronic
1116406598 14:44574136-44574158 TTTTATTTCATTAGTTTTGGAGG - Intergenic
1116727678 14:48582124-48582146 TTTTATGTAGGAAGTTTGGGTGG - Intergenic
1116860411 14:49991022-49991044 TTTTATTTCAGTGGTTTTGGGGG + Intronic
1116910080 14:50452630-50452652 TTCTATTTATTGAGTTTAGAGGG - Intronic
1117693633 14:58336688-58336710 GTTTATTCATGGAGACTTGGTGG + Intronic
1119366128 14:74093245-74093267 TCTTATAAATGTAGTTTTGGGGG - Intronic
1119792243 14:77362104-77362126 TTTTTTTTGTAGAGTTTTTGGGG + Intronic
1120470759 14:84920941-84920963 TGTTTTTTATTAAGTTTTGGAGG + Intergenic
1120517133 14:85484205-85484227 TTTTATTTAAGTAGTTTTGGGGG + Intergenic
1120785512 14:88531137-88531159 ATTTATTTATATAGTTTTGAGGG - Intronic
1120805244 14:88740556-88740578 TTTTAGTTCTGGAGTTTATGTGG - Exonic
1121018639 14:90564902-90564924 TTTTATTTATTTATTTTTTGAGG - Intronic
1121218792 14:92269516-92269538 TTTTATTTCAGTAGTTTTTGGGG + Intergenic
1121621790 14:95355203-95355225 TTTTATTTGTATATTTTTGGGGG - Intergenic
1122331658 14:100921328-100921350 TTTTATTTCAATAGTTTTGGGGG + Intergenic
1122426615 14:101612028-101612050 TTTTTTTTTTGTATTTTTGGTGG - Intergenic
1202901037 14_GL000194v1_random:39266-39288 TTTTATTTTTGTATTTTTAGTGG - Intergenic
1123668727 15:22631248-22631270 TTTTATTAATTGATTTTTGAGGG + Intergenic
1123812031 15:23936865-23936887 TTTTATTTATTTATTTTTGATGG - Intergenic
1124524703 15:30437725-30437747 TTTTATTAATTGATTTTTGAGGG + Intergenic
1124773950 15:32569987-32570009 TTTTATTAATTGATTTTTGAGGG - Intergenic
1124782086 15:32645703-32645725 TTTTATTTTTTTAGTTTTTGTGG - Intronic
1125208669 15:37184683-37184705 TTTTATTGTTTTAGTTTTGGGGG + Intergenic
1125496631 15:40201555-40201577 TTTATTCTATAGAGTTTTGGGGG - Intronic
1125776873 15:42223817-42223839 TTTAATTTCTGCAGATTTGGTGG - Intronic
1126484596 15:49166326-49166348 CTATATTTATGTAGTTATGGAGG - Intronic
1126600510 15:50423280-50423302 TTTTATTTCAGTAGTTTTGGAGG + Intergenic
1126604677 15:50463913-50463935 TTTAATTTATTTACTTTTGGGGG - Intronic
1126606024 15:50477256-50477278 TTTTATTTTTGGAATTTTAGTGG + Exonic
1126642963 15:50846345-50846367 TTTTATTTCAATAGTTTTGGGGG - Intergenic
1126719817 15:51566637-51566659 TTTAATTTATACTGTTTTGGGGG + Intronic
1126776293 15:52103503-52103525 TTTAATTGATGGAGTTAAGGAGG - Intergenic
1126874350 15:53023634-53023656 TTTTTTTTATGGAGTGATGAAGG - Intergenic
1127198795 15:56620566-56620588 TTTTACTTACTGAGATTTGGAGG + Intergenic
1127486474 15:59422476-59422498 TTTTATTTATTTATTTTTTGAGG + Intronic
1127527798 15:59811022-59811044 TTTTATTTATTTATTTTTTGGGG - Intergenic
1127729346 15:61784237-61784259 TTTTATTTTGATAGTTTTGGGGG - Intergenic
1127895365 15:63294052-63294074 TTTAATTTTCGGTGTTTTGGGGG + Intronic
1127959962 15:63883447-63883469 TGTTAATTGTGGAGATTTGGGGG + Intergenic
1128168290 15:65486962-65486984 TTTTATTTCAGTAGTTTTTGAGG - Intronic
1129953972 15:79616318-79616340 GTATATTTATGGAGTTATTGAGG + Intergenic
1130082429 15:80745767-80745789 TTTTATTTCAATAGTTTTGGGGG - Intronic
1130763603 15:86847536-86847558 TTTTATTCATGGATTTTTAAAGG + Intronic
1130813291 15:87404917-87404939 TTTTATTTTTGGAGAGATGGGGG + Intergenic
1131780952 15:95858172-95858194 TTCTATTTATGGATTTATTGAGG - Intergenic
1132838662 16:1967517-1967539 TTTAGTTTAGGGAGATTTGGTGG - Intronic
1133259543 16:4539062-4539084 TAATATTTATTGAGTTTGGGAGG + Intergenic
1133292769 16:4734013-4734035 TTTTCTTTATGTGGTTGTGGTGG - Exonic
1133331091 16:4974576-4974598 TTTTATTTAAACAGTTTTTGGGG + Intronic
1133454928 16:5933738-5933760 TTTTAATAATGAAGTTTGGGAGG + Intergenic
1133679813 16:8110319-8110341 TTTTCTTTTTGTAGTTTAGGAGG - Intergenic
1133941450 16:10312504-10312526 TTTTATTTTTGGATTTTTAGTGG - Intergenic
1134178097 16:12024956-12024978 TGGTATTTAGAGAGTTTTGGTGG + Intronic
1135223205 16:20631978-20632000 TTTTATTTTAGTAGTTTTGGGGG - Intronic
1135227840 16:20676819-20676841 TTTTATTTATTTATTTTTTGGGG - Intronic
1135271551 16:21074076-21074098 TTTTATTATAGGAGTATTGGCGG + Intronic
1135283956 16:21177315-21177337 TATCACTTACGGAGTTTTGGTGG - Intronic
1135346531 16:21693480-21693502 TTTTATTGTGGGAGTGTTGGTGG + Intronic
1135389752 16:22080922-22080944 TTTTATTTTTTTATTTTTGGAGG + Exonic
1135697902 16:24606286-24606308 TTTTATTTTTGTAGATTTAGGGG - Intergenic
1135704140 16:24660084-24660106 TTTTATTTCTGTAGGTTTTGGGG + Intergenic
1135713679 16:24741834-24741856 TTTTATTTATTTATTTTTTGGGG + Intronic
1135795658 16:25439805-25439827 TTTTTTTTTTGTTGTTTTGGTGG + Intergenic
1136670347 16:31850775-31850797 TTTTACTTATGTTGTTTTTGAGG - Intergenic
1136999974 16:35221438-35221460 TTGTATTTATTTATTTTTGGTGG + Intergenic
1137062924 16:35808805-35808827 TTTTTTTTTTGGAATTTTAGTGG + Intergenic
1137478868 16:48834575-48834597 TTTTGTTGTTGTAGTTTTGGGGG - Intergenic
1137762847 16:50954613-50954635 TTTTGTTTATTTTGTTTTGGGGG - Intergenic
1137863921 16:51874151-51874173 TTTTATTTCTGAAGGTTTTGGGG - Intergenic
1137935180 16:52628309-52628331 TTTTATTTTAATAGTTTTGGGGG - Intergenic
1137965281 16:52926593-52926615 TTTTATTTCAAGAGTTTTTGGGG - Intergenic
1138720288 16:59072107-59072129 TTTTATTTTAGTAGTTTTAGTGG - Intergenic
1139027860 16:62841255-62841277 TTTTATTTTAGGAATTTTAGTGG + Intergenic
1140790011 16:78382480-78382502 TCTAATTAATGGAGATTTGGGGG + Intronic
1140901374 16:79371133-79371155 TTTTTTTTTTGGTGTTTTGGTGG + Intergenic
1142277325 16:89127537-89127559 TTTTATTTTTGTAGAGTTGGGGG + Intronic
1143178859 17:4972202-4972224 TTATATTGATGGAGTTATGGGGG - Intronic
1144107501 17:11998838-11998860 TTTTTTTTTTGTATTTTTGGTGG + Intergenic
1144179625 17:12739860-12739882 TTTTATTTCAATAGTTTTGGGGG + Intronic
1144398385 17:14869001-14869023 TTTTTTTTTTGGCGTTTGGGTGG - Intergenic
1144532260 17:16050702-16050724 GATTATTTACAGAGTTTTGGAGG - Intronic
1145848105 17:28062113-28062135 TCTTATTTATGCAGTTTTAACGG - Intronic
1145850479 17:28089894-28089916 TTTTTTTTATTGAGCTTTGAGGG + Intronic
1146252258 17:31357919-31357941 TTTTATTAATGGAGTGTAGCCGG + Intronic
1146424172 17:32720097-32720119 TTATATTTATTCATTTTTGGGGG + Intronic
1146493291 17:33297973-33297995 TCTTATTTCTGTAGTTTTCGTGG + Intronic
1147505303 17:41010418-41010440 CTTTATTTTTAGAGTTTTAGTGG - Intronic
1149154089 17:53605730-53605752 TTTGATTGAAGGAGTTTTGTGGG - Intergenic
1149160164 17:53683659-53683681 TTGTATTTCTGTAGTGTTGGTGG + Intergenic
1149172919 17:53834615-53834637 ATTTATTTATGTATTTTTGATGG + Intergenic
1149382223 17:56105679-56105701 AGTTAATTTTGGAGTTTTGGGGG + Intergenic
1149437259 17:56643908-56643930 TTTTAGTTAAGAAGCTTTGGTGG + Intergenic
1149555575 17:57571121-57571143 TTTCATTTCTGGAGCTGTGGTGG + Intronic
1150236228 17:63594999-63595021 TTTTATTTTAATAGTTTTGGGGG + Intergenic
1150951146 17:69802924-69802946 TTCTTTGTATGGAGTTTTAGAGG + Intergenic
1150993145 17:70284254-70284276 TTTTATTTATTAACTTTTGGGGG + Intergenic
1151275878 17:73033963-73033985 TTTCATTCTTAGAGTTTTGGAGG - Intronic
1151617202 17:75221198-75221220 TTTTATTTATTTATTTTTTGAGG + Intronic
1151618982 17:75233597-75233619 TTTTATTTATTTATTTTTTGGGG + Intronic
1152082985 17:78200032-78200054 TTTTTTTTATGTCGTTGTGGGGG - Intronic
1152982813 18:294918-294940 TGTTATTTATGAACTTTTGCAGG - Intergenic
1153176491 18:2379545-2379567 TTTTTTTTAATGAGTTTTGAGGG - Intergenic
1153446699 18:5180755-5180777 TTTTATTTTTGCATTTTGGGGGG - Intronic
1153604164 18:6814706-6814728 TTTTGATTATGTAGTTTTGAGGG - Intronic
1153755908 18:8282761-8282783 ATTTATTTACAGAGTTTTGTGGG - Intronic
1153787761 18:8549791-8549813 TTTTATTTTTTCAGATTTGGGGG - Intergenic
1153886371 18:9471173-9471195 TTTTATTTCAATAGTTTTGGGGG + Intergenic
1153996288 18:10444757-10444779 TTTTATTTATTGATTTTAGCCGG - Intergenic
1154480797 18:14822112-14822134 ATTTATTTATTTATTTTTGGTGG + Intronic
1155701259 18:28746597-28746619 TTGTGATTTTGGAGTTTTGGAGG + Intergenic
1155890279 18:31260014-31260036 TTTTATTTCAATAGTTTTGGTGG + Intergenic
1156014600 18:32533654-32533676 TTTTATTTATGGTGATTTGATGG - Intergenic
1156068967 18:33181377-33181399 TTTTATTTTTATAGTTTTAGGGG - Intronic
1156193556 18:34747350-34747372 TTTTATTTCAATAGTTTTGGGGG + Intronic
1156694565 18:39751498-39751520 TGGTATTTATGGAGTTTTAAGGG - Intergenic
1156890060 18:42180363-42180385 TTGTAGTTCTGGAATTTTGGGGG + Intergenic
1157135453 18:45049797-45049819 ATTTAATTATGGAATTTAGGGGG + Intronic
1157299339 18:46468160-46468182 TGTTGTTTATGGAGATATGGGGG - Intergenic
1157945576 18:51976001-51976023 TTTTATTTCCAGAGTTTTGGGGG - Intergenic
1158599356 18:58843801-58843823 TTTTAATTATAGGGTTTTGGGGG - Intergenic
1159236340 18:65678992-65679014 TTGTATTTAAATAGTTTTGGGGG - Intergenic
1159363501 18:67435714-67435736 TTTTATTTAAGAAGTTTTGCAGG - Intergenic
1159429304 18:68330636-68330658 TTTTGTTTTTAGATTTTTGGTGG - Intergenic
1160446522 18:78932021-78932043 TTCTACTTTTGGAGTTGTGGTGG - Intergenic
1161401783 19:4069005-4069027 TTTTTTTAATAGAGATTTGGTGG + Intergenic
1161927157 19:7309583-7309605 TTTTATTTCAGTAGTTTTGAGGG - Intergenic
1162825307 19:13247693-13247715 TTTTATTTATTTATTTTTGACGG - Intronic
1164728254 19:30481681-30481703 TTTTATTTCTATAGTTTTTGGGG + Intronic
1164933032 19:32189807-32189829 TTTATTTTATGCAGCTTTGGAGG - Intergenic
1165597037 19:37017914-37017936 TTTTGTTTATGGAGTCTTTTGGG - Intronic
1166143111 19:40816045-40816067 TTTTTTTTTTGGAGGGTTGGGGG - Intronic
1166180735 19:41106570-41106592 TTTTATTTATTTATTTTTGTGGG + Intergenic
1166346168 19:42167451-42167473 TTTTTTTTTTGGAGTTTGGGGGG - Intronic
1167243253 19:48358058-48358080 TTTTATTTCAGTAGTTTTTGGGG - Intronic
1168183828 19:54684122-54684144 TTTTTTTTTTGTATTTTTGGTGG + Intronic
1168366316 19:55791057-55791079 TTTTATTTATAAAGTTTTATTGG + Intronic
1168579489 19:57542657-57542679 TTTTTTCTTTGGAGTTTTTGTGG - Exonic
1202675441 1_KI270711v1_random:1902-1924 TTTTATTTATTTGTTTTTGGGGG + Intergenic
1202708280 1_KI270714v1_random:166-188 TTTTATTTATTTGTTTTTGGGGG - Intergenic
925246371 2:2387167-2387189 TGCTATTTATGGAGGTGTGGAGG - Intergenic
926031649 2:9595825-9595847 TATTATCTTGGGAGTTTTGGTGG + Intronic
926699555 2:15794431-15794453 TTTTATTTGTGGAGCGGTGGAGG - Intergenic
926777800 2:16439466-16439488 TTTTCCTGATGGAGTTTTTGGGG - Intergenic
927258988 2:21067857-21067879 TCTTAATTAAGGAGTTTCGGGGG - Intergenic
927410063 2:22815007-22815029 TTTTTTACATGGAGTTTTGCAGG + Intergenic
928032517 2:27793997-27794019 TTTTATTAAAGAAGTTTTGGGGG + Intronic
928192359 2:29184135-29184157 TTATATTTAGGGTGATTTGGGGG + Intronic
928498336 2:31859059-31859081 TTTTATTTATTTGGTTTTTGAGG - Intergenic
928831255 2:35486912-35486934 TTTTAATTATTGACTTTTGAGGG + Intergenic
928941213 2:36729412-36729434 TTTTCTTCATGTAGTTTTGCTGG + Exonic
929007085 2:37406366-37406388 GTTTATTATTGGAGTTTGGGAGG - Intergenic
929154369 2:38776168-38776190 TTATATTAATGTAGTTTTAGTGG - Intronic
929836831 2:45410041-45410063 CTTTTATTATTGAGTTTTGGGGG - Intronic
929985995 2:46733094-46733116 TTTTATTTATTTATTTTTTGAGG + Intronic
930299031 2:49592560-49592582 TTTTATTTCAATAGTTTTGGGGG - Intergenic
930441146 2:51407985-51408007 TTTTTTTTTTCCAGTTTTGGAGG + Intergenic
930926647 2:56826301-56826323 CTTTATTTTTGCATTTTTGGTGG + Intergenic
931040078 2:58287572-58287594 TGTCATTCATGGGGTTTTGGAGG + Intergenic
931126358 2:59282377-59282399 TTTTATTTATTTAGTTTTTAAGG - Intergenic
931331285 2:61287160-61287182 TTTCCTTTTTGGAATTTTGGGGG - Intronic
931646537 2:64426977-64426999 TTTTATAATTGGATTTTTGGGGG + Intergenic
932252075 2:70253235-70253257 TTTTTTTTTTGGAGGTTGGGGGG + Intergenic
932683595 2:73848895-73848917 TTTTATTTTTTAAGTTTTTGTGG + Intronic
932880383 2:75495751-75495773 TTTTATTTCAATAGTTTTGGGGG - Intronic
933073625 2:77894085-77894107 TGTCATTTATTGTGTTTTGGGGG - Intergenic
933221747 2:79698058-79698080 ATTTATTTATTTATTTTTGGTGG + Intronic
933403842 2:81832741-81832763 TTTTTTTTTTGTATTTTTGGTGG + Intergenic
934505756 2:94891845-94891867 TTTTATTTTTGTATTTTTAGTGG + Intergenic
934883067 2:98000062-98000084 TTTTTTTTTTTGAGTTTTGTTGG + Intergenic
934919176 2:98328758-98328780 TTGAATTTATAGAGGTTTGGGGG - Intergenic
935019027 2:99212702-99212724 TTTTTTTTGTGGAGTTGTGGGGG + Intronic
935123984 2:100206649-100206671 TTTTATTTATATAATTTTGATGG - Intergenic
935249826 2:101251722-101251744 TTGTATTTCAGTAGTTTTGGGGG - Intronic
935825488 2:106944512-106944534 TTTTACTTCTGGAGTTTTGCTGG + Intergenic
936272334 2:111058662-111058684 TTTTATCTATGGTGCTTTGTGGG - Intronic
936798050 2:116230968-116230990 TTATATTTATGTAGAGTTGGTGG - Intergenic
936852497 2:116917728-116917750 TTTTATTTAAGTAGTTTCAGGGG - Intergenic
937542119 2:122969187-122969209 ATTTATTTGTCCAGTTTTGGAGG + Intergenic
937569418 2:123337765-123337787 TTGTATTTCTGTAGGTTTGGTGG - Intergenic
937579008 2:123461047-123461069 TTTTATTTATTTATTTTTTGGGG + Intergenic
937772945 2:125743469-125743491 TTTTATTTCAATAGTTTTGGGGG + Intergenic
938017044 2:127875963-127875985 TTTTTTTTTTGGAGATATGGGGG + Intronic
938057587 2:128228300-128228322 TTTTTTTTTAGGAGTTTGGGAGG + Intergenic
938077754 2:128349085-128349107 TTTTATTTTTAAAGTTTTTGTGG + Intergenic
938247013 2:129785571-129785593 TTCTATTTTTGGAGTGGTGGAGG - Intergenic
938418111 2:131121254-131121276 TTTTATTTATTTATTTTTTGAGG + Intronic
939203855 2:139074358-139074380 TTTTATTTATTTATTTTTTGAGG - Intergenic
939315373 2:140542705-140542727 TTTTATTCATGGAGTTCTCTGGG - Intronic
939369335 2:141277907-141277929 TTTTATTTTGGGATTTTTGAGGG - Intronic
939419735 2:141951196-141951218 TTTTATTTCAATAGTTTTGGGGG + Intronic
939457764 2:142460575-142460597 TTTTATAAATGAAGTTTTGTTGG - Intergenic
939822365 2:146972664-146972686 TTTTATTTATTGTGATTTGTAGG - Intergenic
939836890 2:147140562-147140584 TTTTATTTTTGGAGGTGTGGAGG - Intergenic
940247908 2:151639452-151639474 TTTTTTTTATAAAGTTTTTGTGG - Intronic
940321602 2:152383285-152383307 TTTTTTTTTTGTAGTTTAGGGGG + Intronic
940372152 2:152915589-152915611 TTTTTTTTTTTTAGTTTTGGAGG + Intergenic
940391991 2:153142901-153142923 TTGTAATTATGCAGTTTTGCAGG + Intergenic
940706859 2:157116602-157116624 TTATAGTTTTGGAATTTTGGGGG - Intergenic
940858590 2:158749597-158749619 ATTTATTTATTTATTTTTGGGGG - Intergenic
941307210 2:163884943-163884965 TTATATTAATGATGTTTTGGAGG - Intergenic
941563307 2:167076821-167076843 ATTTATTTATTTGGTTTTGGGGG + Intronic
942002865 2:171666757-171666779 TTTTATTTCAGTAGCTTTGGGGG - Intergenic
942054098 2:172166508-172166530 TTTTATTTATTTATTTTTTGGGG + Intergenic
942072267 2:172326651-172326673 TTTTATTTAGAGAGTTTTGCTGG + Intergenic
942213492 2:173695039-173695061 TTTTATTTCAATAGTTTTGGGGG - Intergenic
942216355 2:173723165-173723187 ATTTATTTATGGGGTTTTTAAGG - Intergenic
942387165 2:175454754-175454776 TTTTATTTCAGTAGTTTTTGGGG + Intergenic
942476859 2:176335720-176335742 TTTTATTTTGGGAAGTTTGGGGG + Intronic
942820391 2:180106962-180106984 TTGTATTTAGGCAGATTTGGGGG - Intergenic
942826494 2:180183517-180183539 CTCTATTTTTGTAGTTTTGGGGG - Intergenic
943243438 2:185416910-185416932 TTTTTTTTTTGGTGATTTGGGGG + Intergenic
943368049 2:186983833-186983855 TTTTATTTATTTATTTTTTGAGG + Intergenic
943599815 2:189902359-189902381 GTTTATTTTTGTATTTTTGGAGG + Intronic
943714971 2:191141219-191141241 TTTTATTTCAGTAGTTTTTGGGG - Intronic
943778184 2:191791285-191791307 ATTTATTTATGAAGTTTTACTGG + Intergenic
943856362 2:192798302-192798324 TTCTCCTAATGGAGTTTTGGTGG - Intergenic
944233580 2:197421147-197421169 TTTTGTTTATGGCTTTTTGGGGG - Intronic
944587891 2:201188826-201188848 TTTTATATATTGAATTTTGAGGG + Intronic
945015167 2:205507580-205507602 CCTTATTTATGGAGTCTGGGTGG - Intronic
945221846 2:207491409-207491431 TTTTATTTATGGGCTTCTAGGGG - Intergenic
945609712 2:211984750-211984772 TTTTTTAGATGGAGTTTTGCTGG + Intronic
945763004 2:213937661-213937683 TATTAATTATGCACTTTTGGGGG - Intronic
945981027 2:216310770-216310792 TTTTATTAATCTACTTTTGGGGG + Intronic
946137814 2:217662504-217662526 TTTTATTTATTTATTTTTTGGGG - Intronic
946290645 2:218742137-218742159 TTTTTTTTGTAGAGTTGTGGGGG + Intronic
946557746 2:220877806-220877828 CTTTATTTATGAAGTTTAGATGG - Intergenic
946801749 2:223424861-223424883 TTTTATTTCAATAGTTTTGGAGG + Intergenic
946894689 2:224311377-224311399 TTTTATTTATGGTGCTTCTGAGG - Intergenic
946966004 2:225038890-225038912 TTTTATTTATGGAATGTTTTAGG - Intronic
947092996 2:226534162-226534184 ATTTGTTTTTGGGGTTTTGGGGG + Intergenic
947411347 2:229843714-229843736 TTTTATTTATTTATTTTTTGTGG - Intronic
947475078 2:230438284-230438306 TTTCATTTCAGTAGTTTTGGGGG + Intronic
947684614 2:232071905-232071927 TTTTATTTCTGGAGATTTGTAGG + Intronic
948194719 2:236086882-236086904 TTTTATTTGCAGATTTTTGGAGG - Intronic
948559411 2:238841484-238841506 TTTTATTTATTTATTTTTTGAGG - Intergenic
1169397417 20:5245016-5245038 TTTTATTTCAATAGTTTTGGGGG + Intergenic
1169479043 20:5960932-5960954 ATTTATTTATGTATTTTTTGAGG - Intronic
1169593258 20:7168923-7168945 TTCTTTTTATGGAGTTTAAGAGG - Intergenic
1170867052 20:20167398-20167420 ATTTATTTGAGGAGTTTTTGAGG - Intronic
1171071733 20:22075674-22075696 TTAAAGTTATTGAGTTTTGGGGG + Intergenic
1171274276 20:23842375-23842397 TTTTCTTCATGAAGTTTTGAAGG + Intergenic
1171378362 20:24711705-24711727 TTTTATTTAAAAAGTTTTTGAGG + Intergenic
1171893345 20:30737332-30737354 TTTTATTTTTGTATTTTTAGTGG + Intergenic
1171951217 20:31424215-31424237 TTCTAGTTGTGGAGTCTTGGAGG - Intergenic
1172381652 20:34498226-34498248 TTTTATTGGTGGAGTTTTTAAGG + Intronic
1173775161 20:45699492-45699514 TGTTATTTCTGTAGTTTTTGAGG - Intronic
1173894907 20:46543346-46543368 TTTTTTTTTTGGAGTCTTGCTGG + Intronic
1174240355 20:49129093-49129115 TTTTTATTATTGAGTTTTGGAGG - Intronic
1175233062 20:57487521-57487543 TTTTATTTCAAGAGTTTTTGGGG - Intergenic
1175409894 20:58760488-58760510 TTTTATTTATTTATTTTTTGGGG + Intergenic
1175446309 20:59022613-59022635 TTTTATTTAAGGAGTTCAGGTGG + Intronic
1175570404 20:60014845-60014867 TTCTATTTGTAGAGTTTTTGAGG + Intronic
1175702516 20:61150470-61150492 TTTTTTTTTTTTAGTTTTGGAGG + Intergenic
1176620411 21:9054044-9054066 TTTTATTTTTGTATTTTTAGTGG - Intergenic
1176690922 21:9907887-9907909 TTTTATATATTAAGTTTTTGGGG - Intergenic
1176799754 21:13414139-13414161 ATTTATTTATTTATTTTTGGTGG - Intergenic
1177908866 21:27005826-27005848 TTTTATTTCAATAGTTTTGGGGG + Intergenic
1178114039 21:29398721-29398743 ATTCATTCATGGAGTTTTGCTGG - Intronic
1178307808 21:31505010-31505032 TTTTATTTTTGGTGTTTCTGAGG - Intronic
1178454487 21:32735515-32735537 CTTTATTTAGTGAATTTTGGTGG - Intronic
1179108972 21:38428895-38428917 TTTAATTTAAATAGTTTTGGGGG + Intronic
1180836673 22:18933160-18933182 TTTTATTTATTTATTTTTAGAGG + Intronic
1181389089 22:22566329-22566351 TTTTATTCATTGATTTTTAGTGG + Exonic
1183562972 22:38591150-38591172 TTTTATTTTTGTAGAGTTGGGGG - Intronic
1184181874 22:42833914-42833936 TTCTATTTATTTATTTTTGGGGG - Intronic
1184186843 22:42870631-42870653 TTTTAAATATGGCGATTTGGGGG + Exonic
1184283261 22:43451034-43451056 TTTTTTTGATGGAGTCTTGCTGG + Intronic
1184473031 22:44706690-44706712 TTTTTTTTTTGTATTTTTGGTGG + Intronic
1184625714 22:45727223-45727245 GTGTATTTATGTAGTTTTGAGGG + Intronic
1185261397 22:49866502-49866524 TTTTATTTTTAGTGTTTTTGTGG + Intronic
1203286765 22_KI270734v1_random:158459-158481 TTTTATTTATTTATTTTTAGAGG + Intergenic
950245751 3:11416415-11416437 TTTTCTTATTTGAGTTTTGGTGG + Intronic
950618940 3:14186617-14186639 ATTTATTTATGTATTTTTGCTGG + Intronic
950894481 3:16435881-16435903 TTTTATTTATTTACTTTTTGTGG - Intronic
951117108 3:18876923-18876945 TTTTATTTATTTATTTTTGGGGG - Intergenic
951704146 3:25526854-25526876 TTTTAATAATGGAGTTCTGCTGG + Intronic
952832850 3:37579476-37579498 CTTTATTTATGGAGTTTTCCTGG + Intronic
952943838 3:38462858-38462880 TTTTATTTATTTATTTTTTGAGG + Intronic
952994292 3:38862874-38862896 TTTTATTTCAGTAGTTTTTGGGG - Intronic
953342389 3:42146554-42146576 TTTTATTTTTTTAGTTTTTGGGG + Intronic
953480245 3:43245309-43245331 TTTTAGGTTGGGAGTTTTGGTGG - Intergenic
953530272 3:43734422-43734444 TCTTATATATTGGGTTTTGGGGG - Intergenic
953653356 3:44826141-44826163 TTTCTTTTTTGAAGTTTTGGAGG - Exonic
953940221 3:47088069-47088091 TTTTATTTCTGGTTTTGTGGTGG - Intronic
954546259 3:51437812-51437834 TTTTATTTATTGTTTTTTTGAGG - Intronic
955484554 3:59422804-59422826 TTTTGCTTTTGGAGTTTTGTGGG + Intergenic
956417267 3:69045743-69045765 TTTTATTTATTTATTTTTTGAGG - Intronic
956478158 3:69645577-69645599 TTTTATTTCAGTAGCTTTGGAGG - Intergenic
956507594 3:69959147-69959169 TTTTATTTCAATAGTTTTGGGGG - Intronic
956538506 3:70307180-70307202 TTTTATTGTTGTTGTTTTGGTGG + Intergenic
956924226 3:73966214-73966236 TTTTATTTATGATGCTTTGAGGG + Intergenic
956960012 3:74388557-74388579 TTTATTTTATAGATTTTTGGGGG - Intronic
957364808 3:79209013-79209035 TTTTATTTCAATAGTTTTGGGGG + Intronic
957569803 3:81931987-81932009 TTCTATTGATGTGGTTTTGGGGG - Intergenic
957711986 3:83873101-83873123 TTTTATTTATTTATTTTTTGTGG - Intergenic
957740205 3:84256275-84256297 TTTTATTTAAAGATTTTTGATGG - Intergenic
957836690 3:85602934-85602956 TTTTATTTTTGCTTTTTTGGTGG + Intronic
958003694 3:87784981-87785003 TTTTATTAATGGTATTTTAGGGG + Intergenic
958051207 3:88349141-88349163 TTTTATTTCAATAGTTTTGGGGG + Intergenic
959151470 3:102613013-102613035 TTTTATTTGTGGATTGTTAGGGG + Intergenic
959156127 3:102668071-102668093 TTGAATTTCAGGAGTTTTGGGGG - Intergenic
959252710 3:103967757-103967779 TTTTATTCTTGGTGTTTTAGGGG - Intergenic
959928393 3:111951765-111951787 TTTTATTTTCATAGTTTTGGGGG + Intronic
960075518 3:113480477-113480499 TTTCATTAATGGAGTATTGGAGG - Intronic
960125160 3:113990590-113990612 TTTTATTTCTGTAGGTTTTGGGG - Intronic
960392513 3:117095777-117095799 TTTTATTTGTTTTGTTTTGGAGG - Intronic
960711825 3:120537924-120537946 TTTTATTTCTATAGTTTTTGGGG + Intergenic
961218975 3:125184942-125184964 TTTTATTTGTGTAAGTTTGGTGG - Intronic
961967629 3:130922749-130922771 ATGTATTTATGTAGTTTTGAGGG + Intronic
962237605 3:133719991-133720013 TTTTTTTGATGGAGTTTTTAGGG + Intergenic
962493151 3:135913617-135913639 TTTAATTCATGGAGTTTGGGTGG + Intergenic
962613068 3:137097354-137097376 TTTTAGCTATGGAGGTTGGGTGG - Intergenic
962810192 3:138952840-138952862 TTTTATTTAAACAGTTTTGGGGG + Exonic
963325826 3:143861958-143861980 TTTAATTTTTGTAGATTTGGGGG - Intergenic
963806090 3:149724485-149724507 TTTTTTTTAAGGAGTCTGGGGGG - Intronic
964276627 3:155015347-155015369 TTTTATTTCAATAGTTTTGGGGG - Intergenic
964837852 3:160959430-160959452 TTTTATTTCAGTAGTTTTTGGGG - Intronic
965155417 3:165046700-165046722 TTATTTTTATGGAGTTTATGAGG - Intronic
965345642 3:167545845-167545867 TTTTATTTCAATAGTTTTGGGGG - Intronic
966004767 3:174996645-174996667 TTTTATTTCAACAGTTTTGGGGG + Intronic
966830144 3:184001069-184001091 TTATAGTGATGGGGTTTTGGAGG - Intronic
967629610 3:191730082-191730104 TGTTATCTATGGAGCTTTTGGGG - Intergenic
967747594 3:193075922-193075944 TTTTATTAATGGATTTTTGATGG - Intergenic
968031981 3:195507828-195507850 TTTTTTTTTTGTATTTTTGGTGG - Intergenic
968168114 3:196485189-196485211 ATTTATTTATGAAAGTTTGGTGG - Intronic
968937731 4:3621353-3621375 TTTTATTTTTTTAGATTTGGGGG - Intergenic
969250627 4:5966097-5966119 TTTTATTTCAATAGTTTTGGGGG - Intronic
969407586 4:7004226-7004248 TTCTAAATATGGAGATTTGGAGG + Intronic
970252703 4:14133010-14133032 TTTTATTTATCATTTTTTGGAGG - Intergenic
970268855 4:14321187-14321209 TTTTATTTCAATAGTTTTGGGGG - Intergenic
970571201 4:17384587-17384609 TTTTATTTTTTTATTTTTGGGGG + Intergenic
970706230 4:18806233-18806255 TTTTATTTAAATAGTTTTGGGGG - Intergenic
971009983 4:22423193-22423215 ATTTATTTATTTATTTTTGGGGG - Intronic
971090523 4:23338152-23338174 TTTTTTTTCTTCAGTTTTGGTGG - Intergenic
971166083 4:24185227-24185249 ATTTATTTATTTATTTTTGGAGG - Intergenic
971192118 4:24437637-24437659 TTTTAGTTTTGGTTTTTTGGGGG + Intergenic
972005214 4:34093631-34093653 TTTTAATTTTTGAGTTTTGTAGG - Intergenic
972210236 4:36827679-36827701 TTCTATTTATGGTTTTTTGAGGG - Intergenic
972510970 4:39768860-39768882 TTTTATTTATCTATTTTTGATGG + Intronic
972920953 4:43941120-43941142 TATTAATTTTGGAGTTTTGAAGG + Intergenic
973036818 4:45417138-45417160 TTTTATTTTAATAGTTTTGGGGG + Intergenic
973317417 4:48776812-48776834 TTTTAATAAAGTAGTTTTGGGGG - Intronic
973549433 4:52018078-52018100 TTTTACTCATAGAGTTATGGAGG - Intergenic
973611000 4:52635995-52636017 TTCTAGTTATGGAGGTTAGGGGG - Intronic
973666959 4:53170057-53170079 TTTTGTTGCTGGAGTTTTTGGGG + Intronic
974196942 4:58587090-58587112 TTTTATTTCAATAGTTTTGGGGG - Intergenic
974304096 4:60108819-60108841 TTTGATTTTTTGGGTTTTGGTGG + Intergenic
974413142 4:61567709-61567731 TTTTATTTAGGGTTGTTTGGAGG - Intronic
974961483 4:68706824-68706846 TTTTATGTGTGGAGGTGTGGAGG - Intergenic
975147445 4:70984706-70984728 TTTAATTGATGGAGTAGTGGTGG + Intronic
975232098 4:71947521-71947543 TTTTATTTAATGATTATTGGTGG + Intergenic
976330068 4:83821415-83821437 TTTTCTTCTTGGGGTTTTGGGGG + Intergenic
976418449 4:84808186-84808208 TTTTACTTTTGGGGTTTTGGGGG - Intronic
976506865 4:85857566-85857588 TTATCTTTATGCAGTTTTGGTGG + Intronic
976868053 4:89755083-89755105 TATACTTAATGGAGTTTTGGGGG - Intronic
976992895 4:91390789-91390811 TTTTCTTGAGTGAGTTTTGGCGG + Intronic
977066659 4:92325411-92325433 TTATATTTATGAAGTTTTGAGGG - Intronic
977096283 4:92748994-92749016 ATTTATTTATTTATTTTTGGAGG + Intronic
977695514 4:99960534-99960556 TTTTATTTCAGTAGTTTTTGGGG - Intergenic
977729850 4:100338189-100338211 TTTTTTTTATATAGGTTTGGGGG - Intergenic
977779526 4:100964391-100964413 TTATTTTTATAGGGTTTTGGGGG - Intergenic
977849582 4:101809468-101809490 ATTTATTTCAGTAGTTTTGGGGG - Intronic
978043967 4:104103861-104103883 ATGTATTTATATAGTTTTGGGGG - Intergenic
978101317 4:104843765-104843787 TTTTTTTTTTGTAGTTTTAGAGG - Intergenic
978129879 4:105183025-105183047 TTTTATTTTTCGTATTTTGGGGG - Intronic
978593386 4:110350996-110351018 CTTTATTTAAGCAGTTTGGGAGG + Intergenic
978963720 4:114715729-114715751 ATTTATTGATTGATTTTTGGAGG + Intergenic
979010351 4:115359223-115359245 ATTTATTTATTTATTTTTGGTGG - Intergenic
979168227 4:117564265-117564287 TTTTATTTCAATAGTTTTGGGGG + Intergenic
979319568 4:119307353-119307375 TTTTATTTCTGTAAGTTTGGTGG - Intergenic
979453536 4:120900791-120900813 TATATTTTGTGGAGTTTTGGGGG + Intronic
979453558 4:120901091-120901113 TTTTATTTCAGTAGCTTTGGGGG + Intronic
979463338 4:121007657-121007679 TTTTATTTCAGTAGTTTTTGGGG - Intergenic
979506506 4:121503118-121503140 TTTTATTTCAATAGTTTTGGGGG + Intergenic
979509658 4:121537911-121537933 TTTTATTTCAATAGTTTTGGGGG + Intergenic
979786801 4:124725296-124725318 TATCATTTATGTAGATTTGGGGG + Intergenic
979836528 4:125375926-125375948 TTTTATATATGAAGTTGTTGAGG + Intronic
980239534 4:130155815-130155837 TTTTATTGAGGGACTTCTGGAGG + Intergenic
980363501 4:131768111-131768133 TTTTATATATTAAGTTTTTGGGG - Intergenic
981024366 4:140062007-140062029 TGCTATTTATGGTTTTTTGGAGG - Intronic
981064233 4:140464245-140464267 TTTTCTTTATTAAGTTTTGAGGG + Intronic
981335534 4:143565019-143565041 TTTTATTTCAATAGTTTTGGAGG + Intergenic
981515031 4:145598518-145598540 TATTCTTTGTGAAGTTTTGGGGG + Intergenic
981651780 4:147068479-147068501 TTTTATTTCGCTAGTTTTGGGGG - Intergenic
982100268 4:151960385-151960407 TACTAGTTATGCAGTTTTGGGGG - Intergenic
983535324 4:168851231-168851253 TTTAATTTATGGGGGTATGGAGG - Intronic
984002080 4:174260736-174260758 TTATATTTAAGGCTTTTTGGTGG - Intronic
984308289 4:178022972-178022994 ATTTTTTTCTGGAATTTTGGGGG + Intergenic
984343062 4:178483721-178483743 TTTTTTTTTTGTATTTTTGGTGG + Intergenic
984353416 4:178624537-178624559 TTTTTTTCAAGGAGTTTTGTAGG + Intergenic
984401424 4:179270519-179270541 TTTTATTTTTCTATTTTTGGAGG + Intergenic
985267458 4:188163328-188163350 TTTTATTTTTGTAGAATTGGAGG - Intergenic
985451009 4:190062551-190062573 TTTTCTTTATAGAATTTTGTTGG + Intergenic
985751748 5:1682995-1683017 TTTTATTTGTGTAGTTTTGATGG - Intergenic
985935725 5:3096446-3096468 TTTTATTTCAGGAGTTTTGGGGG - Intergenic
986051146 5:4091544-4091566 TTTTATTTCAATAGTTTTGGGGG - Intergenic
986065983 5:4234562-4234584 CTTTATTTGTTTAGTTTTGGCGG - Intergenic
986103794 5:4640428-4640450 ATTTGGTTATGGAATTTTGGTGG - Intergenic
986227916 5:5834196-5834218 TTTTATTTTAGTAGTTTTGGTGG - Intergenic
986504607 5:8435919-8435941 TTTTATTTCAATAGTTTTGGGGG - Intergenic
986771224 5:10975741-10975763 GTTTTCTTATGGATTTTTGGGGG + Intronic
986874290 5:12088282-12088304 TTTTATTTCAATAGTTTTGGGGG - Intergenic
986984671 5:13487115-13487137 TTTAATGTATGGATTTTTGGTGG - Intergenic
987427639 5:17792006-17792028 TTTAATTTCAGTAGTTTTGGGGG - Intergenic
987443252 5:17983645-17983667 TTTTATTTCAATAGTTTTGGGGG - Intergenic
987520274 5:18973455-18973477 TTTTATTTTTATAGATTTGGGGG - Intergenic
987884174 5:23791917-23791939 TTTTAATTATTTATTTTTGGAGG - Intergenic
988017817 5:25582219-25582241 TTTTATTTCCATAGTTTTGGGGG + Intergenic
988151738 5:27391691-27391713 TTATATGTATATAGTTTTGGGGG - Intergenic
988170276 5:27645002-27645024 TTTTATTTATGCAATATTTGAGG - Intergenic
988472688 5:31555309-31555331 TTTTTTTTTTGTATTTTTGGTGG - Intergenic
989006655 5:36822031-36822053 TTTTACTTCAGAAGTTTTGGGGG + Intergenic
989091841 5:37742071-37742093 TTTTATGTTTTCAGTTTTGGAGG + Intronic
989446309 5:41533856-41533878 TTTTTTTTATGGAGTCCAGGTGG + Intergenic
989467070 5:41769277-41769299 TTTTAATTATTAAATTTTGGGGG - Intronic
989683239 5:44054436-44054458 TTTTATTTCAATAGTTTTGGGGG + Intergenic
990255579 5:53965284-53965306 ATTTATTCATGGTATTTTGGTGG + Intronic
990563213 5:57004182-57004204 TTTTATTTATATAGGTTTTGGGG - Intergenic
990699775 5:58461659-58461681 TTTTACAAATGGAGTTTTGTGGG + Intergenic
991150040 5:63357088-63357110 TTTTCTTTTTTCAGTTTTGGTGG + Intergenic
991415851 5:66392188-66392210 TTTTATTTAAATAGTTTTGGGGG - Intergenic
991595133 5:68296398-68296420 ATTCATTCATTGAGTTTTGGGGG + Intronic
992925429 5:81580178-81580200 ATTAATTTATGGACTTTAGGAGG + Intronic
992979069 5:82148086-82148108 TTTTATTAATAAAGTTTTGTTGG + Intronic
993177363 5:84503770-84503792 TTTTATTTTTTCAGTTGTGGAGG + Intergenic
993310278 5:86321819-86321841 TTTTATTTTTGGAGTCTTTATGG - Intergenic
994415674 5:99467079-99467101 TTTTATTTCAGTAGTTTTAGGGG - Intergenic
994458981 5:100050038-100050060 TTATAATTAAGGAGTTTTGGAGG + Intergenic
994595240 5:101824424-101824446 TTTTATTTCAATAGTTTTGGGGG + Intergenic
994636326 5:102348675-102348697 TTATATTTCTGCAGTATTGGTGG - Intergenic
994803463 5:104411754-104411776 TTTTATTTCTGCAATTTTGTGGG - Intergenic
995239141 5:109865952-109865974 CATTATTTATGAGGTTTTGGAGG - Intronic
996326462 5:122280388-122280410 TTTTATTTCAATAGTTTTGGGGG + Intergenic
996668125 5:126084457-126084479 TTTTATTTAAATAGTTTTGGGGG - Intergenic
997279852 5:132634138-132634160 TTTAATTTATGGATTATTTGAGG + Intronic
997991573 5:138548731-138548753 TTATATTTATGGTCTTTTGTGGG + Intergenic
998144063 5:139716211-139716233 TTTAACTTATGAATTTTTGGAGG + Intergenic
999370902 5:151054676-151054698 TTTTTTTTAAGGGGTGTTGGGGG - Intronic
999462230 5:151767639-151767661 TTTTATTTATTTATTTTTTGAGG + Intronic
999753950 5:154650664-154650686 TTTTTTTTTTGTAGTTTTAGTGG + Intergenic
999853228 5:155565259-155565281 TTTCCTTTCTGGAGTTCTGGAGG + Intergenic
999930230 5:156424377-156424399 TGTTATTTGTGGAGAATTGGAGG - Intronic
1000235993 5:159361011-159361033 TTTTATTTCAATAGTTTTGGGGG - Intergenic
1000474844 5:161693639-161693661 TTTTATTTTTGCAGATATGGGGG - Intronic
1000653303 5:163845013-163845035 TTTTATTTATACAGTGTTTGTGG + Intergenic
1001158565 5:169294307-169294329 TTTTATTTATTTATTTTTGGGGG - Intronic
1001626347 5:173138460-173138482 TTTTGTTTAGAGAGTTTTGGAGG + Exonic
1002973451 6:2049118-2049140 TTTTACTTTTGCAGTTCTGGAGG - Intronic
1003376748 6:5585961-5585983 TTCAATTTATGGATTTATGGAGG + Intronic
1003415247 6:5901615-5901637 TTTTATTTTTATAGATTTGGGGG - Intergenic
1003709808 6:8576503-8576525 TTTTTTTTTTGTATTTTTGGTGG + Intergenic
1003744844 6:8988894-8988916 TTTTTTTTTTGTATTTTTGGTGG + Intergenic
1003858691 6:10301691-10301713 TTTTATTTATTTATTTTTGAGGG - Intergenic
1003867404 6:10375880-10375902 TTTTATTTTTCAAATTTTGGTGG + Intergenic
1004610478 6:17235027-17235049 TTTTATTTCAGTAGTTTTGGGGG - Intergenic
1004624880 6:17365269-17365291 TTTTCTTAATGTTGTTTTGGAGG + Intergenic
1004626311 6:17380586-17380608 TTTTATTTATTTATTTTTGGGGG + Intergenic
1004732558 6:18372470-18372492 TTTTGTTTATGAGGTGTTGGAGG - Intergenic
1004738156 6:18429017-18429039 TTTTATTTTTGTAGATATGGGGG - Intronic
1004763997 6:18703543-18703565 TTTTGTTTAATGAGTTTTGTAGG + Intergenic
1004776770 6:18856011-18856033 CTTTATTTATGAAGCTTAGGTGG + Intergenic
1004959175 6:20766287-20766309 TCTTAATTCTGGGGTTTTGGTGG + Intronic
1005396665 6:25389349-25389371 TTTTCTTTTTTGAGATTTGGGGG + Intronic
1005493222 6:26366331-26366353 TTTTATAGTTGGAATTTTGGGGG + Intronic
1007038011 6:38695731-38695753 TTTTCTCTATGGAGTTTAGTTGG + Intronic
1007157097 6:39756030-39756052 TTTTATTTCAATAGTTTTGGGGG + Intergenic
1007490088 6:42214020-42214042 TTTTATTCATAGAGTGTTTGGGG + Intronic
1007806248 6:44451020-44451042 TTCTGTTTATTGAGGTTTGGGGG + Intergenic
1007837630 6:44686411-44686433 TTTTATTTCACTAGTTTTGGGGG + Intergenic
1007870577 6:45032673-45032695 TTTTATTTATGAAGGTTATGAGG - Intronic
1008246860 6:49186600-49186622 TTTTATTTATAGGGTTTTAATGG - Intergenic
1008340718 6:50360672-50360694 TTTTATTTAAATAGTTTTAGAGG - Intergenic
1008407785 6:51138235-51138257 TGATATTTATGGAGTATTGCAGG + Intergenic
1008554252 6:52659520-52659542 TTTTATTTATTTATTTTTCGAGG + Intergenic
1009159375 6:60262758-60262780 TCTTTTTTTTGCAGTTTTGGGGG + Intergenic
1009318046 6:62248181-62248203 TTTTATTTTTGGAATTATAGAGG - Intronic
1009935286 6:70226883-70226905 TTTTCTTTATGGAGTTTTTGTGG - Intronic
1009998502 6:70924146-70924168 TTTTATTTTTTAAATTTTGGGGG - Intronic
1010248812 6:73687285-73687307 TTTTAGTTATTCACTTTTGGAGG - Intergenic
1010457279 6:76072072-76072094 TTTTATTTGTTGAATTTCGGTGG + Intronic
1010975157 6:82303733-82303755 TTTTATTTATCCTGTTTTGGGGG - Intergenic
1011465665 6:87654052-87654074 ATTTTTTAATGGAGTTTTGGGGG + Intronic
1011627607 6:89296336-89296358 TCTTATTTATGGACTCATGGAGG + Intronic
1011731579 6:90269866-90269888 TTTTATTTCAATAGTTTTGGGGG + Intronic
1011937336 6:92797120-92797142 ATTTATTTATGGGGGGTTGGGGG - Intergenic
1012202846 6:96427159-96427181 TTTTATTTCAGTAGTTTTTGAGG + Intergenic
1012780782 6:103554534-103554556 TTTTTTTTTTGGTGTTATGGAGG + Intergenic
1012819831 6:104072347-104072369 TTTTATTTCAATAGTTTTGGGGG + Intergenic
1012943742 6:105444105-105444127 TTTTACTTGTTGACTTTTGGAGG - Intergenic
1013381016 6:109570556-109570578 TTTTATTTCAGTAGTTTTAGGGG - Intronic
1013456395 6:110333462-110333484 ATTTATTTATGTATTTTTTGAGG + Intronic
1013926833 6:115482930-115482952 TTTTATTTATGAAATTTTCATGG + Intergenic
1014157213 6:118125359-118125381 ATTCATTTATGGTATTTTGGGGG + Intronic
1014296581 6:119626098-119626120 TTTTATTTTTGTATTTTTAGTGG + Intergenic
1014439463 6:121457363-121457385 TTGTATTTATGGTTTTTGGGGGG - Intergenic
1015368739 6:132426340-132426362 TTTTATTTTTGGAATATTTGAGG + Intergenic
1015504278 6:133965589-133965611 TGTTATTGTTGGAGTTTTGTGGG + Intronic
1015565066 6:134561375-134561397 TTTTATTTCAATAGTTTTGGGGG + Intergenic
1015868406 6:137751307-137751329 TTTTATTTTTGCAGTGATGGGGG + Intergenic
1016029705 6:139324658-139324680 TTTTATTTATTTATTTTTTGGGG + Intergenic
1016130699 6:140465412-140465434 TTATAGTTCTGGAGTTCTGGTGG + Intergenic
1016362233 6:143279699-143279721 TTTTCTTAATGGGGTCTTGGTGG - Intronic
1016524127 6:144980919-144980941 TTTTATTTCTGGTGCTTTTGGGG + Intergenic
1016966151 6:149720160-149720182 TTTTATTTATTTATTTTTTGGGG - Intergenic
1017126618 6:151070691-151070713 TTATTTTTATGAAGTTTTAGTGG - Intronic
1018097375 6:160400973-160400995 TTTTTTTTTTTCAGTTTTGGAGG - Intronic
1018498914 6:164381433-164381455 TTTTATTTCAGTAGCTTTGGGGG + Intergenic
1018505145 6:164459279-164459301 TTGTCTTTTTGGTGTTTTGGGGG - Intergenic
1018556246 6:165053235-165053257 TTTAATTGATGGAGCTCTGGTGG - Intergenic
1018750436 6:166799765-166799787 TTTTATTTTAATAGTTTTGGGGG + Intronic
1018781254 6:167068074-167068096 TTTTATTTTAATAGTTTTGGGGG + Intergenic
1019097799 6:169599381-169599403 ATTTATTTATGGACTTTTTTTGG + Intronic
1019191935 6:170256564-170256586 TTTGATTTTTGGATTTTTTGGGG - Intergenic
1019683984 7:2370130-2370152 TTTTATTTTTTTATTTTTGGTGG + Intronic
1020249550 7:6456542-6456564 ATTTATTTATTTATTTTTGGGGG + Intronic
1020331846 7:7026503-7026525 TTTTATTTCAATAGTTTTGGAGG + Intergenic
1020689063 7:11332019-11332041 TTTTATCAATGAAGTGTTGGAGG - Intergenic
1020715280 7:11667061-11667083 TTTTATTTCAATAGTTTTGGGGG + Intronic
1020841723 7:13225915-13225937 TTTTATTTTTTTAGTTTTTGAGG - Intergenic
1020850223 7:13344010-13344032 ATTTATTTGTATAGTTTTGGTGG + Intergenic
1020897062 7:13953389-13953411 TTTTATTTTTGGAACTTTGCAGG - Intronic
1021052951 7:16012041-16012063 TTTTATTTCAATAGTTTTGGGGG + Intergenic
1021290453 7:18836996-18837018 TTTAATTAATGAAGTTTTGGTGG + Intronic
1021540079 7:21747981-21748003 TTTTCTTTTTGGACTTTTGGTGG + Intronic
1021724719 7:23537842-23537864 TTTTATTTATATAGTTTTTGGGG - Intergenic
1021725234 7:23542201-23542223 TTTGTTTTTTGGTGTTTTGGGGG + Intergenic
1022161354 7:27714310-27714332 TTTACTTGATGGAGTTTTGGAGG + Intergenic
1022279068 7:28887731-28887753 TTTTATTTCAGTAGTTTTGGGGG + Intergenic
1022690877 7:32651927-32651949 TTCTATTTATAGTGTTTTTGAGG - Intergenic
1023207590 7:37767486-37767508 TATGATTTAAGGAGTTTTGGGGG - Intronic
1023475901 7:40577419-40577441 TTTTTTTTATGGCATGTTGGGGG + Intronic
1023495746 7:40794821-40794843 TTCTATTTATGGAAATATGGTGG - Intronic
1024296772 7:47850150-47850172 TTTTATTTCAGTAGTTTTTGGGG - Intronic
1024483757 7:49893156-49893178 TTTTATATCTTGAATTTTGGTGG + Intronic
1024514997 7:50241624-50241646 TTTTATTTAAATAGTTTTTGGGG - Intergenic
1025091204 7:56065595-56065617 ATTTATTTATTTATTTTTGGTGG + Intronic
1025735753 7:64145337-64145359 TTTTATTTATTTAATTTTTGGGG - Intronic
1025886647 7:65601101-65601123 TTTTCTTTATGGGGTTTAGTGGG + Intergenic
1026391121 7:69903124-69903146 TTTTCTCAATGGAGATTTGGGGG + Intronic
1026423056 7:70260408-70260430 ATTTATTTCTGCAGTTATGGAGG + Intronic
1026536059 7:71239300-71239322 TTTTATTTATTTTTTTTTGGGGG - Intronic
1026975964 7:74498610-74498632 TTTTATTTACTTAGTTTTGGGGG - Intronic
1027001078 7:74654808-74654830 TTTTATTTATTGATTTTTTTGGG - Intergenic
1027897090 7:84058880-84058902 TTTTCTTTGTGGACTTTGGGTGG + Intronic
1028120656 7:87053289-87053311 TTTCATTTAAGGCATTTTGGGGG - Intronic
1028904834 7:96141191-96141213 TTATATTTATTTATTTTTGGAGG + Intronic
1028996274 7:97103950-97103972 GTTTATTTCAGCAGTTTTGGGGG - Intergenic
1029165486 7:98586593-98586615 TATTATTAATTAAGTTTTGGAGG - Intergenic
1029214674 7:98938335-98938357 TTTTATTTATTTATTTTTTGAGG - Intronic
1029556016 7:101269732-101269754 TTTTATTTATTGTTTTATGGGGG + Intergenic
1029967818 7:104758593-104758615 ATTTATTTATATATTTTTGGTGG - Intronic
1030212127 7:107006710-107006732 TTTTATTTATTTATTTTTTGAGG - Intergenic
1030235798 7:107260678-107260700 TTTTTTTTATGTAGCTTTGTAGG - Intronic
1030253162 7:107472722-107472744 TTTTATTTATGAACTTTTTTGGG - Intronic
1030477363 7:110053244-110053266 TTTTATTTCAGTAGTTTTTGAGG + Intergenic
1030560613 7:111080005-111080027 TTTTTTTTTTGTAGTTCTGGAGG - Intronic
1030592336 7:111497016-111497038 TTTTATTAATGTAGTTTTACAGG - Intronic
1030818860 7:114072462-114072484 TTATCTGTATGGAGATTTGGTGG - Intronic
1031391250 7:121217590-121217612 TTTTATTCTTAAAGTTTTGGGGG + Intronic
1031420234 7:121542901-121542923 TTTTATTTATGTAGTTATTTAGG - Intergenic
1031438330 7:121760915-121760937 TTTGATTTCTGCAGTTTTGCAGG - Intergenic
1031535728 7:122930979-122931001 TTTTATTTTTGTAGATTTAGGGG + Intergenic
1031638522 7:124132357-124132379 TTACATTTATGAAGATTTGGAGG - Intergenic
1032245892 7:130212193-130212215 ATATATTTATGGAGTATTGGGGG + Intronic
1032250750 7:130255209-130255231 TTTTTCTTATAGAGTTTTGTAGG + Intergenic
1032794759 7:135268706-135268728 TTTTATTGAAGGAGCTCTGGAGG + Intergenic
1032811185 7:135419876-135419898 TTTTTTTTTTGGATTTTTAGTGG - Intronic
1032861846 7:135887376-135887398 ATTTATTTAAGGATTTTTGTTGG - Intergenic
1033900111 7:146127213-146127235 TTTTATCTATGCTGTTTTAGAGG + Intronic
1035439965 7:158888870-158888892 TTTTATTTCTTTAATTTTGGTGG + Intronic
1035927859 8:3748253-3748275 TTTTTTTCATGGAGGTTTAGTGG + Intronic
1035944081 8:3939994-3940016 TTTTATTTCAGTAGTTTTTGGGG - Intronic
1036065685 8:5379257-5379279 TTTAATTTAGACAGTTTTGGGGG - Intergenic
1036446705 8:8827944-8827966 TTTTATCTAAGGAATGTTGGAGG + Intronic
1036500386 8:9308905-9308927 TTTTATTTCAATAGTTTTGGGGG + Intergenic
1036508027 8:9373757-9373779 TTTTAATTGTTGAGTTTTGAAGG - Intergenic
1036514778 8:9433708-9433730 TTTTATGTTTGTTGTTTTGGGGG - Intergenic
1036647598 8:10621629-10621651 TGATATTTATGAAGTATTGGTGG + Intronic
1036727999 8:11237491-11237513 TTTTATTTATTTATTTTTTGGGG + Intergenic
1036918764 8:12831719-12831741 TTTTATTTATTTATTTTTTGGGG - Intergenic
1037745990 8:21644473-21644495 TTTTATTTATACAGAGTTGGGGG - Intergenic
1038196488 8:25372942-25372964 TTTTATTTCAGTAGGTTTGGGGG + Intronic
1038268318 8:26053144-26053166 TTTTATTTATAATTTTTTGGTGG + Intergenic
1038362013 8:26889703-26889725 TTTTAGTTCTAGAATTTTGGGGG + Intergenic
1038874546 8:31533514-31533536 TTATTTTAGTGGAGTTTTGGAGG + Intergenic
1039030572 8:33304707-33304729 TTTTATTTTCAAAGTTTTGGGGG - Intergenic
1039597432 8:38803151-38803173 TTTCATTTATAGTTTTTTGGTGG + Intronic
1041424270 8:57702813-57702835 TTTCATTTATTTATTTTTGGTGG - Intergenic
1041679878 8:60577806-60577828 TTTTTTTTTTGGATTTTTAGTGG + Intronic
1041813251 8:61936470-61936492 TTTTATTTTTGGAGTTCTGGAGG - Intergenic
1042151084 8:65784967-65784989 TTTTTTTTTTGGAGATTTGTAGG - Intronic
1042230553 8:66550040-66550062 TTTTAAAGATGGAGTTTTGCTGG - Intergenic
1042391969 8:68246247-68246269 TTTTATTTTAATAGTTTTGGGGG + Intergenic
1042400422 8:68339047-68339069 TTTTATTTGGGTTGTTTTGGGGG + Intronic
1042458292 8:69031239-69031261 TTTTATTAATCGTGTTTTGAGGG - Intergenic
1043068581 8:75609187-75609209 TTTCATTTAAGTAATTTTGGTGG - Intergenic
1043191481 8:77228052-77228074 TTTTTTTTTTGTATTTTTGGTGG + Intergenic
1043292362 8:78618687-78618709 TTTGAATTTTGGAATTTTGGGGG + Intergenic
1043377833 8:79669843-79669865 TTTAATTTACTGAGATTTGGGGG - Intergenic
1043545364 8:81309451-81309473 TTGTATTTCTGTAGTATTGGTGG - Intergenic
1043752922 8:83963459-83963481 TTTTATTTATGGGTTGGTGGTGG - Intergenic
1044080538 8:87876951-87876973 TTTTATTTCAATAGTTTTGGGGG + Intergenic
1044433495 8:92135687-92135709 TTTTATTTATTTCTTTTTGGTGG + Intergenic
1044671905 8:94690295-94690317 TTTTTTTTTTGGATTTTTAGTGG + Intronic
1044673754 8:94709593-94709615 TTTTTTTTTTGTAGTTTTAGTGG + Intergenic
1044891692 8:96842863-96842885 TTTTCTTCCTGGAGTTTTGAGGG + Intronic
1044953677 8:97457851-97457873 TTTTATTTCAGTAGTTTTTGGGG - Intergenic
1045195402 8:99925549-99925571 TTTTATTTTTGTAGATTTAGGGG - Intergenic
1045465747 8:102468292-102468314 ATTTATTTTTCCAGTTTTGGAGG + Intergenic
1045614109 8:103886082-103886104 TTTGATTTATGAGGCTTTGGTGG - Exonic
1046252946 8:111657163-111657185 ATTTATTTTTGGCGCTTTGGTGG - Intergenic
1046334749 8:112771019-112771041 TTTTATTTATAGATTTTTAGAGG - Intronic
1046715710 8:117564346-117564368 TTATACTTATTGAATTTTGGGGG - Intergenic
1046799250 8:118407070-118407092 TTTTATTTCAATAGTTTTGGGGG - Intronic
1046827241 8:118704577-118704599 TTTTATTTCGATAGTTTTGGGGG + Intergenic
1047402583 8:124558885-124558907 TTTTATTTATTATATTTTGGTGG - Intronic
1047552482 8:125890216-125890238 TTTTATTTTTATAGTTTTAGAGG + Intergenic
1047645505 8:126865957-126865979 TTTTATTTTTGTATTTTTAGTGG + Intergenic
1047905441 8:129468100-129468122 ATTTATTCATCGAATTTTGGGGG + Intergenic
1047971777 8:130090870-130090892 TTTTGTGTTTTGAGTTTTGGGGG - Intronic
1048073685 8:131045211-131045233 TTTCATTTAGGTAGTTGTGGTGG + Intergenic
1048531236 8:135252276-135252298 TTTTTTTTATTTATTTTTGGTGG - Intergenic
1048811751 8:138294375-138294397 TTTTATTTAAGTAGCTTTTGGGG - Intronic
1048914943 8:139173558-139173580 TTTTATATATGGATATTTGAAGG - Intergenic
1049836836 8:144740964-144740986 TTTTATTTATTTATTTTTGGGGG - Intronic
1050478892 9:6069412-6069434 TTTTATTTTTGTAGAGTTGGGGG + Intergenic
1050867387 9:10519976-10519998 TTGTATTTCTCTAGTTTTGGGGG - Intronic
1051280652 9:15439975-15439997 TTTTATTTATGGGGTTTATTGGG + Intronic
1051782715 9:20707811-20707833 TGTTATTTTGGGAGTGTTGGTGG + Intronic
1051804554 9:20977509-20977531 CTTTATTTTTGGAGTTAGGGTGG - Intronic
1051807117 9:21006881-21006903 TGTTATGTCTAGAGTTTTGGGGG + Exonic
1051831544 9:21284689-21284711 ATTTATTTTTGTAGTTTTAGTGG + Intergenic
1052139881 9:24967553-24967575 TTTAATTTTTACAGTTTTGGGGG - Intergenic
1052846064 9:33337531-33337553 TTTTATTTTTTGAGTTTTAAAGG + Intronic
1053125090 9:35574643-35574665 TTGTAGTTATGAAGTTTTAGGGG - Intergenic
1053208704 9:36209527-36209549 TTTCATATTTGGGGTTTTGGAGG + Intronic
1053262763 9:36684608-36684630 TTTTATTTCAGTAGTTTTTGGGG + Intergenic
1053395601 9:37771151-37771173 TTTTTTTGTTGGAGTTTTAGAGG + Intronic
1053522730 9:38797377-38797399 TTTTATTTCAATAGTTTTGGAGG + Intergenic
1053627660 9:39892417-39892439 TTTTATATATTAAGTTTTTGGGG - Intergenic
1054194955 9:62021797-62021819 TTTTATTTCAATAGTTTTGGAGG + Intergenic
1054216228 9:62358292-62358314 TTTTATATATTAAGTTTTTGGGG + Intergenic
1054355293 9:64055402-64055424 TTTTATTTTTGTATTTTTAGTGG - Intergenic
1054643453 9:67566893-67566915 TTTTATTTCAATAGTTTTGGAGG - Intergenic
1054671254 9:67797058-67797080 TTTTATATATTAAGTTTTTGGGG - Intergenic
1054762100 9:69012980-69013002 TTTTGTTTTTGGTGGTTTGGGGG - Exonic
1054863945 9:69980847-69980869 TTGAATTTAAGGAATTTTGGGGG - Intergenic
1054880835 9:70142944-70142966 TTTTCTTTATGTTGTTTAGGAGG + Intronic
1055093853 9:72390039-72390061 ATTTATTTATGTATTTTTTGAGG - Intergenic
1055698241 9:78912258-78912280 TTTTATTTATAGAGATGGGGGGG - Intergenic
1055982647 9:82019904-82019926 TTTTATTTTTGGGGACTTGGAGG + Intergenic
1056355548 9:85798064-85798086 TTTTTTTTTTGTATTTTTGGTGG + Intergenic
1056614611 9:88153137-88153159 TTTTATGTATTGTGCTTTGGGGG + Intergenic
1056690543 9:88804916-88804938 ATTTATTTATTTATTTTTGGGGG + Intergenic
1056897026 9:90560459-90560481 TTTTATTTCAATAGTTTTGGGGG - Intergenic
1056920970 9:90789013-90789035 TTTTATTGATGGGGTTGGGGTGG - Intergenic
1057368088 9:94442860-94442882 GTTAATTTTTGGAGTTTTGGGGG - Intronic
1057479206 9:95430963-95430985 TTTTCTTTTTGGAGAATTGGAGG + Intergenic
1057932223 9:99204519-99204541 ATTTATTTATTTATTTTTGGGGG + Intergenic
1058069724 9:100589625-100589647 TTTAATTTATGGAGGCTTCGGGG - Intergenic
1058348638 9:103994915-103994937 TTTTATTTCAGTAATTTTGGGGG - Intergenic
1059306015 9:113353699-113353721 TTTTATTTATTTATTTTTTGAGG - Intronic
1059760550 9:117333488-117333510 TTTTGGTTATGGTGTTTTGGAGG - Intronic
1060025612 9:120168263-120168285 TAGAATTTATGGAGTTTGGGTGG - Intergenic
1060589229 9:124805748-124805770 TTTTATTTAAATAGTTTTTGGGG - Intronic
1060834742 9:126746622-126746644 TTTTATTTTTGTATTTTTGGTGG + Intergenic
1061101606 9:128496541-128496563 TGTTATTTACGGATTGTTGGAGG + Intronic
1203743622 Un_GL000218v1:24499-24521 TTTTATTTTTGTATTTTTAGTGG - Intergenic
1203566489 Un_KI270744v1:95040-95062 TTTTATTTTTGTATTTTTAGTGG + Intergenic
1185519482 X:728122-728144 TTTTATTTATTTAGATTTGTGGG + Intergenic
1185549235 X:970097-970119 TTTTATTTATGGAGTGTCTATGG - Intergenic
1186049962 X:5581272-5581294 TTTTCTTTTTGGAGTTTTACAGG - Intergenic
1186120093 X:6351236-6351258 TTTTATTGTTGTTGTTTTGGGGG - Intergenic
1186276985 X:7949754-7949776 TTTTTTTTTTGGAGCTTTGGAGG + Intergenic
1186506253 X:10095173-10095195 TTTTATTTATTTAATTTCGGGGG - Intronic
1187128365 X:16475827-16475849 TTTTATTTCAATAGTTTTGGGGG - Intergenic
1187309378 X:18126555-18126577 TCTAATTTTTGTAGTTTTGGTGG - Intergenic
1187422817 X:19150997-19151019 TTATATTTGTGGCCTTTTGGAGG + Intergenic
1187842159 X:23500158-23500180 TTTTATTTTTGTATTTTTAGTGG + Intergenic
1188058832 X:25575455-25575477 TTTAATTTATGTTGTTTTGAAGG - Intergenic
1188365858 X:29314216-29314238 TATTTTTTATAGAGTTTTGAGGG + Intronic
1188393880 X:29656276-29656298 TTTTATTTCAATAGTTTTGGGGG + Intronic
1188459475 X:30407124-30407146 TTTTATTTATGGAGATGTTATGG - Intergenic
1188787808 X:34370193-34370215 TTTTATTTCAATAGTTTTGGGGG - Intergenic
1189011974 X:37054712-37054734 TTTTGTTTATAGTGTCTTGGTGG + Intergenic
1189036732 X:37501573-37501595 TTTTGTTTATAGTGTCTTGGTGG - Intronic
1189237565 X:39499407-39499429 TTTTATTTCCATAGTTTTGGAGG + Intergenic
1189584663 X:42446128-42446150 TTTTATTTGAATAGTTTTGGGGG - Intergenic
1189703262 X:43733565-43733587 TTTTATTTGTATAGTTTTTGAGG - Intronic
1189712297 X:43826182-43826204 CTTTATTTGTGGAATTTGGGTGG + Intronic
1190048528 X:47131956-47131978 TATTATTTCAGTAGTTTTGGGGG + Intergenic
1190254100 X:48749580-48749602 TTTTCATTGTTGAGTTTTGGGGG - Intergenic
1191097843 X:56692738-56692760 TTTTATTTCAAGAGTTTTTGGGG - Intergenic
1191180207 X:57554066-57554088 TTTTATTTTAATAGTTTTGGTGG - Intergenic
1192015941 X:67331087-67331109 TTTTATTTCAATAGTTTTGGGGG - Intergenic
1192084968 X:68087060-68087082 TCCTTTTTCTGGAGTTTTGGAGG - Intronic
1192290727 X:69791967-69791989 TTTTATTTCAACAGTTTTGGGGG + Intronic
1192904332 X:75534350-75534372 TTTTATTTCAGTAGTTTTTGGGG + Intergenic
1192954504 X:76054404-76054426 TTTTATTTCATTAGTTTTGGAGG + Intergenic
1193451296 X:81671359-81671381 TTTTATTTCAATAGTTTTGGGGG + Intergenic
1193725707 X:85036707-85036729 TTTTATTTCAATAGTTTTGGGGG + Intronic
1194215456 X:91125065-91125087 TGATATTTATGGAGTTTCTGTGG + Intergenic
1194253645 X:91609151-91609173 TTTTATTTCAATAGTTTTGGGGG - Intergenic
1194669316 X:96710712-96710734 TTTTATTTCAGTAGTTTTGGGGG + Intronic
1194733891 X:97488553-97488575 TTTTCTTCAAGGAGTTTTGTAGG + Intronic
1195565507 X:106334686-106334708 TTTTATTTTTGTGTTTTTGGTGG + Intergenic
1195637331 X:107132983-107133005 ATTCCTTTATGGAGTTTTTGGGG + Intronic
1195773386 X:108376428-108376450 TTTTTTTTTTGTATTTTTGGTGG - Intronic
1195824118 X:108978726-108978748 TTTTATTTCAGTAGTTTTTGGGG + Intergenic
1196246609 X:113406996-113407018 TTTTATTTCAATAGTTTTGGGGG - Intergenic
1196721078 X:118854439-118854461 TTTTTTTTTTGTATTTTTGGTGG - Intergenic
1196891104 X:120291705-120291727 TTTTATTTATGTAGAAATGGAGG + Intronic
1197439625 X:126473187-126473209 TTATAATTAAGGAGATTTGGAGG - Intergenic
1197824895 X:130578869-130578891 TTTTATATATGGTGTGTTGTAGG - Intergenic
1198008893 X:132530276-132530298 TTGTATTTATATAGTTTTGGGGG + Intergenic
1199230025 X:145425804-145425826 TTTTATTTAAGTAGCTTTTGGGG - Intergenic
1199247439 X:145623054-145623076 TTTGATAGAGGGAGTTTTGGTGG - Intergenic
1199293258 X:146129063-146129085 TTTTATTTCAATAGTTTTGGGGG + Intergenic
1199424769 X:147688295-147688317 TTTTATTTCAGTAGTTTTTGGGG - Intergenic
1199590860 X:149467323-149467345 TTTTATTTATTTATTTTTGATGG - Intergenic
1199674394 X:150174002-150174024 TTTTATTTATTTATTTTTGCTGG - Intergenic
1199727341 X:150597472-150597494 CTTCATATATGAAGTTTTGGTGG + Intronic
1200185678 X:154181867-154181889 TTTAATTTTTGGCGTTCTGGTGG - Intergenic
1200191331 X:154219006-154219028 TTTAATTTTTGGCGTTCTGGTGG - Intergenic
1200197086 X:154256810-154256832 TTTAATTTTTGGCGTTCTGGTGG - Intergenic
1200202737 X:154293928-154293950 TTTAATTTTTGGCGTTCTGGTGG - Intronic
1200572428 Y:4848731-4848753 TTTTATTTCAATAGTTTTGGGGG - Intergenic
1200821507 Y:7588671-7588693 TTTTTTTTTTGTAGTTTTAGTGG - Intergenic
1200826765 Y:7653016-7653038 TTTTTTTCATTGAGTTCTGGTGG - Intergenic
1201501700 Y:14650600-14650622 TTTTATATATGGAGTTAGGTAGG + Intronic
1202238798 Y:22744081-22744103 TTTTTTTTTTGTAGTTTTAGTGG + Intergenic
1202257245 Y:22934496-22934518 TTTTTTTTTTGGATTTTTAGTGG - Intergenic
1202410236 Y:24568242-24568264 TTTTTTTTTTGGATTTTTAGTGG - Intergenic
1202460546 Y:25101830-25101852 TTTTTTTTTTGGATTTTTAGTGG + Intergenic