ID: 912770174

View in Genome Browser
Species Human (GRCh38)
Location 1:112456614-112456636
Sequence ACGGGAAAAATCTGTGGCAT TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 150
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 141}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
912770166_912770174 23 Left 912770166 1:112456568-112456590 CCAGGGAGCTGACTGCAGGCAAC 0: 1
1: 0
2: 3
3: 23
4: 223
Right 912770174 1:112456614-112456636 ACGGGAAAAATCTGTGGCATTGG 0: 1
1: 0
2: 0
3: 8
4: 141

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
912770174 Original CRISPR ACGGGAAAAATCTGTGGCAT TGG Exonic
901912172 1:12468348-12468370 AAGGGAAAAACATGAGGCATGGG - Intronic
902960909 1:19962230-19962252 ACGGGAGAGAGCTGTGTCATGGG + Intergenic
904899231 1:33843533-33843555 AGGGGAAGAATCACTGGCATTGG - Intronic
904937830 1:34144349-34144371 ACTGGAAAAATGTGTGCCACTGG - Intronic
912770174 1:112456614-112456636 ACGGGAAAAATCTGTGGCATTGG + Exonic
912785354 1:112597984-112598006 ACGTAAAAAATCTGTGTCACAGG + Exonic
920616897 1:207502535-207502557 ACGGGAAAAATGTGTGTCTTTGG + Intronic
1065168865 10:23008518-23008540 ATGGGAAAGATCTCTGGAATAGG + Intronic
1066950511 10:42112134-42112156 AAGGCAAAAAGCTGTGGCTTTGG + Intergenic
1079558880 11:21796098-21796120 GGGGAAAAAGTCTGTGGCATTGG - Intergenic
1081313993 11:41608768-41608790 ACTGTAAAATTCTGTGGCACTGG - Intergenic
1082768948 11:57190894-57190916 AGGAGAAAAATCTGTGGCAGAGG + Exonic
1083732136 11:64658176-64658198 GCAGGAAAAATCTGGGGCCTTGG - Intronic
1088919324 11:114249995-114250017 AAGGGAAAAGACTGTGGCCTTGG + Intronic
1089724097 11:120458665-120458687 ATGTGATAAATGTGTGGCATGGG + Intronic
1090438608 11:126708122-126708144 ACGGGAAAAGTCAGTGGAAGAGG - Intronic
1090829403 11:130410589-130410611 ACGGGAAAAGACACTGGCATTGG - Intronic
1094200645 12:27791862-27791884 AAGGGAAAAATTTATGTCATTGG + Exonic
1100498610 12:95151230-95151252 ATGTGAAAAATCTGTAGCTTTGG - Intronic
1101247121 12:102894308-102894330 ACGGGTAAATTGTGTGTCATGGG - Intronic
1101361329 12:104030450-104030472 GGGGGAAAGCTCTGTGGCATTGG + Intronic
1101717441 12:107322726-107322748 ACAGGAAGAAACTGAGGCATAGG + Intronic
1110221746 13:73081172-73081194 GAGGGAAAAAGCTGTGGCAAAGG - Intergenic
1111399021 13:87707907-87707929 AGGGGAAAACTTTATGGCATTGG - Intergenic
1111539097 13:89648440-89648462 ACAGGAAACATTTGAGGCATGGG + Intergenic
1111718260 13:91909072-91909094 AAGGGAGAAATCTATGGTATTGG - Intronic
1116454119 14:45098545-45098567 ACGGGAAAAATGAGGGGCAGGGG - Intronic
1119131046 14:72173581-72173603 ACGGAAGAAATGTGTGTCATGGG - Intronic
1121042512 14:90760619-90760641 AGGGGAAAGCTCTGTGTCATCGG + Intronic
1122350215 14:101084674-101084696 ACGGGAAAGCTCTGTGGAAGTGG - Intergenic
1126425338 15:48521636-48521658 ACGGAAAGAGTTTGTGGCATAGG + Intronic
1126854136 15:52821358-52821380 ACGGAAAAAAGATGTGTCATTGG - Intergenic
1126893106 15:53227546-53227568 GTGGGAAAACTCTGTGGCAGTGG + Intergenic
1128282231 15:66405613-66405635 AAGGGAAGAATGTGGGGCATGGG - Intronic
1130219166 15:82003327-82003349 ACGGGAAAACTCTATGAAATTGG + Intergenic
1130823249 15:87517415-87517437 TCAGGAAAGAGCTGTGGCATTGG - Intergenic
1131733996 15:95312784-95312806 ATGGGATAACTGTGTGGCATTGG - Intergenic
1136938662 16:34500031-34500053 AGGGCAAAAAGCTGTGGCTTTGG + Intergenic
1136961156 16:34848526-34848548 AGGGCAAAAAGCTGTGGCTTTGG - Intergenic
1137218885 16:46427724-46427746 AGGGTAAAAAGCTGTGGCTTCGG + Intergenic
1137218984 16:46428184-46428206 AGGGCAAAAAGCTGTGGCTTCGG + Intergenic
1139916289 16:70430479-70430501 ACGGGAAGAGGCTGTGGCATGGG - Intronic
1140295163 16:73702613-73702635 AGGTGAAAAGTCTGTGGGATTGG + Intergenic
1144086397 17:11812760-11812782 AAAGGAAAAAATTGTGGCATTGG - Intronic
1145694043 17:26773844-26773866 GCGGCAAAAATCTGTGGCGACGG - Intergenic
1149582172 17:57758242-57758264 ACCGGAAAGATCTGGGGGATTGG - Intergenic
1151033572 17:70771376-70771398 ACTGGACAATTCTGTGTCATGGG - Intergenic
1203192076 17_KI270729v1_random:199488-199510 GCGGCAAAAAGCTGTGGCAACGG - Intergenic
1153145728 18:2029308-2029330 AGGGGAAAAAGCAGTGGTATTGG + Intergenic
1153334474 18:3908071-3908093 ACTGAAAAAATTTTTGGCATAGG + Intronic
1156675524 18:39523144-39523166 ATGTGAAAAATGAGTGGCATAGG + Intergenic
1156732938 18:40217127-40217149 ACCAGAAAAATCTGTGAGATAGG - Intergenic
1157441046 18:47711876-47711898 ACAGGAAAGACCTGTGGCCTGGG - Intergenic
1158126910 18:54110317-54110339 ACGGGTAAACTCTGTGTCATGGG + Intergenic
1159480979 18:68990721-68990743 ACAGGAAAAATCTATAGGATTGG - Intronic
1160318894 18:77872047-77872069 ACTGGAACTCTCTGTGGCATGGG - Intergenic
1160548161 18:79675719-79675741 ACGGGAAAAATTTATGACATTGG - Intergenic
1166733793 19:45072734-45072756 ACACGAAAAATCTGTGGAGTGGG + Intronic
1167614396 19:50524148-50524170 AATGGTAGAATCTGTGGCATAGG + Intronic
926923976 2:17968228-17968250 ACACTAAAAATCTGTGGCAGAGG + Intronic
928280188 2:29939587-29939609 AAGGGCAAAATCTTTGGCAGAGG + Intergenic
929207429 2:39313124-39313146 ACTGGAAGATTCTGTGGCAGAGG - Intronic
929853015 2:45610491-45610513 AGGGGAAAGATATGTGGCAAAGG + Intronic
932649134 2:73536758-73536780 ACGGCAAAAAACTGGGGCAAAGG + Intronic
934257863 2:91442892-91442914 GCGGGAAAAATCTGCGGCGGCGG - Intergenic
934331435 2:92073365-92073387 AGGGCAAAAAGCTGTGGCTTCGG - Intergenic
935116035 2:100137317-100137339 AAGGGAAAAATCTTTGAAATTGG - Intronic
935544363 2:104385092-104385114 ATTGGGAAAATCTGTGTCATTGG + Intergenic
936399695 2:112155928-112155950 CCGGGAGAAATCTGTGCCAAAGG - Intronic
940025357 2:149200926-149200948 ACAGGAAAAATCAGTACCATAGG + Intronic
942323551 2:174756424-174756446 CCTGGAAAACTATGTGGCATTGG + Intronic
944669452 2:201983224-201983246 AAAGGAAAAATGAGTGGCATGGG - Intergenic
945579250 2:211572346-211572368 ACGCTAACAATCTGTGACATTGG + Intronic
1168733030 20:103769-103791 ACGGGGATGATCTGTGGCTTGGG - Intergenic
1169182099 20:3578578-3578600 AAAGAAAATATCTGTGGCATTGG + Exonic
953191555 3:40692137-40692159 ATGTGAAAATTCTGTGACATTGG - Intergenic
955060687 3:55489365-55489387 AGGCGAAAAATCCGTGGCCTAGG + Intronic
956204526 3:66741629-66741651 ATGGTAAAAATCTGTGACAGGGG + Intergenic
956928260 3:74013009-74013031 GAGGGAAAAATTTGTGGTATTGG - Intergenic
958077699 3:88704531-88704553 TGGGGAAAAGTCTGTGGCAAAGG - Intergenic
959914180 3:111797451-111797473 AAGGAAAAATTCTGTGGCAATGG - Intronic
960445682 3:117746099-117746121 ATGGGCAATATCTGCGGCATGGG + Intergenic
961158040 3:124697480-124697502 ACAGGAAAAAATTGTGACATCGG + Intronic
966014896 3:175130423-175130445 AGGGAAAAGTTCTGTGGCATTGG - Intronic
967697397 3:192548403-192548425 AATGGAAAAAACTGAGGCATAGG + Intronic
968055230 3:195686660-195686682 ACTGGAACAATCTGTGGCCTGGG - Intergenic
968276896 3:197446956-197446978 CCGTGAAAGCTCTGTGGCATAGG + Intergenic
970601310 4:17642984-17643006 ACGGGGAGAATCTGTGGCCCAGG + Intronic
971135821 4:23867283-23867305 AAGGGAAAATTCTGTGTCGTAGG + Intronic
971883069 4:32407284-32407306 AGGGGAAATATTTGTGACATTGG - Intergenic
978111176 4:104965325-104965347 AGGGGAAAACTCTATGACATTGG - Intergenic
980679914 4:136146974-136146996 AAGGGAAAACTCCATGGCATTGG + Intergenic
984489833 4:180418976-180418998 AAGGGGAAAATCTGTTTCATAGG + Intergenic
984651666 4:182277259-182277281 CCAGGAAAAATCTGTGGATTTGG - Intronic
985178815 4:187233524-187233546 GCAGCAAAAATATGTGGCATAGG + Intergenic
987463811 5:18248366-18248388 ATGGAAAAAATCTGTGACCTTGG - Intergenic
994438642 5:99771670-99771692 ACTGGCAATATCTGTTGCATAGG - Intergenic
996926652 5:128834807-128834829 ACTGGAAAAATGTGGGCCATAGG + Intronic
997362432 5:133303613-133303635 ACGGGAACAAGCTGTGTCCTGGG - Intronic
998849629 5:146340560-146340582 AGGGGGAAAGTCTGTGGCTTCGG - Intergenic
999032991 5:148315181-148315203 AAGGGAAAATTCTGTAACATAGG + Intronic
999081408 5:148847838-148847860 AAGGGATCAAACTGTGGCATAGG + Intergenic
1001124040 5:169003490-169003512 ACGAGGAAACTCTATGGCATTGG + Intronic
1005212812 6:23487994-23488016 AGTGGAAACATCTGTGGAATGGG + Intergenic
1006367675 6:33625052-33625074 AAGGGATAAAGCAGTGGCATTGG - Intronic
1006473208 6:34239629-34239651 ACTGGAAAAATGTGTAGCCTAGG + Intronic
1007800752 6:44390299-44390321 ATGGGAAAAATCAGTGGTCTAGG + Exonic
1010818956 6:80390981-80391003 ATGGGAGAAATCTGTGGGCTGGG - Intergenic
1012811389 6:103963686-103963708 CCTGGAAAAGCCTGTGGCATAGG + Intergenic
1013039159 6:106416532-106416554 ATCGGAAAAATCTGTGCCAGAGG - Intergenic
1016702513 6:147069621-147069643 ACGGGTACAATCTGTAACATAGG + Intergenic
1017139350 6:151176506-151176528 ACTGGAAAAATCTAATGCATAGG - Intergenic
1017770374 6:157639668-157639690 ACGGGGGAAATCGGTGGCAGAGG + Intronic
1018664220 6:166119600-166119622 TCAGAACAAATCTGTGGCATTGG - Intergenic
1020508798 7:9025999-9026021 AAGGGAGAAATCTGAGGCCTAGG - Intergenic
1022776927 7:33536406-33536428 ATGGGAAAAATCTGAGTTATAGG - Intronic
1023141497 7:37106691-37106713 AGGGGAACAAAGTGTGGCATTGG + Intronic
1025553626 7:62276655-62276677 GCGGGAAAAACCTGTGGCGGCGG + Intergenic
1027288788 7:76678834-76678856 ACTGGAAAATTATGTGGGATAGG - Intergenic
1031099122 7:117457240-117457262 GAGGAAAAAATCTGTGTCATAGG - Intergenic
1031934830 7:127725800-127725822 AGAGGGAAAGTCTGTGGCATGGG + Intronic
1034006609 7:147479004-147479026 AGGGGAAAGGGCTGTGGCATGGG + Intronic
1036705348 8:11042382-11042404 ACGGGAAAAATCTGTCCCCACGG - Intronic
1038035615 8:23683494-23683516 ACGGGAAAAGGCTTTGGCAAAGG - Intergenic
1042944386 8:74140492-74140514 ACAGGAAAAAGAGGTGGCATTGG - Intergenic
1045416238 8:101970764-101970786 AAGGGAAAGATTTTTGGCATTGG - Intronic
1045721132 8:105112197-105112219 ACAGTAAAAATCTGAGTCATAGG - Intronic
1051318267 9:15867916-15867938 ACATGATAAATCTGTAGCATAGG - Intronic
1051496197 9:17726004-17726026 ATGGCAAGAATCTGTGGCACTGG - Intronic
1053333353 9:37236968-37236990 ACGGGAAACTTCTGAGACATAGG - Intronic
1053946063 9:43311380-43311402 AGGGCAAAAAGCTGTGGCTTCGG - Intergenic
1053946162 9:43311839-43311861 AGGGTAAAAAGCTGTGGCTTCGG - Intergenic
1055337146 9:75244275-75244297 ACGGGTAAATTCTGTGTCACTGG + Intergenic
1056329625 9:85510801-85510823 AGGAGAAAAGTGTGTGGCATGGG + Intergenic
1056404088 9:86257782-86257804 AGGGGAAAAGTCTGTGGTCTTGG + Intronic
1058662785 9:107282271-107282293 ACGGTAAATATTTGTGGAATGGG - Intergenic
1059419400 9:114181598-114181620 GCAGGAATAATCTGGGGCATAGG - Intronic
1203589198 Un_KI270747v1:39960-39982 AGGGCAAAAAGCTGTGGCTTCGG - Intergenic
1203589292 Un_KI270747v1:40397-40419 AGGGTAAAAAGCTGTGGCTTCGG - Intergenic
1185710604 X:2300605-2300627 ACGGGAGAAAGCTGTAGCATGGG - Intronic
1186548287 X:10474660-10474682 TCGGGAAAAATCTAAGGCAAAGG + Exonic
1186567794 X:10682911-10682933 AAGGGTCAAATCTGGGGCATTGG + Intronic
1187528508 X:20075413-20075435 AGGGGAAAAATATGCTGCATGGG + Intronic
1188619224 X:32199498-32199520 AGGGGAAAAATGTGTGTAATTGG - Intronic
1194040323 X:88933872-88933894 ATGGGTAAATTCTGTGTCATGGG + Intergenic
1195517257 X:105791361-105791383 AGGTGAAAAATCTGTGTTATTGG - Intergenic
1196318464 X:114258286-114258308 ACAGGAAAAATTTGAGGCATTGG - Intergenic
1196495248 X:116317352-116317374 TCTGGAAAAATCTGTGTGATTGG + Intergenic
1196669950 X:118355350-118355372 AAGGGAAAAATTGGTTGCATTGG + Intronic
1196939806 X:120763809-120763831 AGGGGAAAAATCTTTACCATTGG + Intergenic