ID: 912775147

View in Genome Browser
Species Human (GRCh38)
Location 1:112502153-112502175
Sequence CGCGCAGGTGCTGCGCCCGC GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 135
Summary {0: 1, 1: 0, 2: 1, 3: 8, 4: 125}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
912775142_912775147 -8 Left 912775142 1:112502138-112502160 CCCGGGCTACTCCGGCGCGCAGG No data
Right 912775147 1:112502153-112502175 CGCGCAGGTGCTGCGCCCGCGGG 0: 1
1: 0
2: 1
3: 8
4: 125
912775137_912775147 14 Left 912775137 1:112502116-112502138 CCCTCACTCTGCGGCTCGCTCTC No data
Right 912775147 1:112502153-112502175 CGCGCAGGTGCTGCGCCCGCGGG 0: 1
1: 0
2: 1
3: 8
4: 125
912775136_912775147 15 Left 912775136 1:112502115-112502137 CCCCTCACTCTGCGGCTCGCTCT 0: 1
1: 0
2: 0
3: 13
4: 319
Right 912775147 1:112502153-112502175 CGCGCAGGTGCTGCGCCCGCGGG 0: 1
1: 0
2: 1
3: 8
4: 125
912775134_912775147 27 Left 912775134 1:112502103-112502125 CCTGAGCGGTCTCCCCTCACTCT 0: 1
1: 0
2: 0
3: 11
4: 136
Right 912775147 1:112502153-112502175 CGCGCAGGTGCTGCGCCCGCGGG 0: 1
1: 0
2: 1
3: 8
4: 125
912775144_912775147 -9 Left 912775144 1:112502139-112502161 CCGGGCTACTCCGGCGCGCAGGT 0: 1
1: 0
2: 0
3: 2
4: 47
Right 912775147 1:112502153-112502175 CGCGCAGGTGCTGCGCCCGCGGG 0: 1
1: 0
2: 1
3: 8
4: 125
912775138_912775147 13 Left 912775138 1:112502117-112502139 CCTCACTCTGCGGCTCGCTCTCC 0: 1
1: 0
2: 0
3: 18
4: 211
Right 912775147 1:112502153-112502175 CGCGCAGGTGCTGCGCCCGCGGG 0: 1
1: 0
2: 1
3: 8
4: 125

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
912775147 Original CRISPR CGCGCAGGTGCTGCGCCCGC GGG Intronic
901207620 1:7505879-7505901 CGTGCAGGTGAAGCGCCCACAGG - Intronic
901272323 1:7961883-7961905 CGCGCCGGTTCTGAGCCAGCGGG - Intronic
903627945 1:24745020-24745042 CGCGCAGGCGCTGCGGCGGGAGG + Intergenic
905862585 1:41361328-41361350 AGCCCAGGTGCCCCGCCCGCGGG - Intergenic
905996015 1:42380985-42381007 CGCGCAGGATCTGCACCTGCGGG - Exonic
906129765 1:43449085-43449107 CTCCCAGGTGCTGCGGCTGCTGG - Intronic
906315941 1:44786447-44786469 GACGCAGGTGCGCCGCCCGCCGG - Exonic
907387714 1:54136734-54136756 CACGCAGGCGCTGGCCCCGCTGG - Intronic
912775147 1:112502153-112502175 CGCGCAGGTGCTGCGCCCGCGGG + Intronic
913972264 1:143424050-143424072 GGAGGAGGTGCTGTGCCCGCTGG + Intergenic
914066646 1:144249663-144249685 GGAGGAGGTGCTGTGCCCGCTGG + Intergenic
914112507 1:144716691-144716713 GGAGGAGGTGCTGTGCCCGCTGG - Intergenic
915328068 1:155091617-155091639 AGCCCAGGTGCTGCGCCACCTGG - Intergenic
922998696 1:229987663-229987685 GGCCCAGGTTCTGCGCCAGCGGG - Intergenic
1063380593 10:5583100-5583122 CGCTTAGGTGCTGAGGCCGCAGG + Intergenic
1065687770 10:28302976-28302998 CGCGGCGGTGCCGAGCCCGCTGG - Intronic
1069419272 10:68231714-68231736 CGCGCAGGTCCTGAGCGGGCGGG - Exonic
1071997800 10:91163805-91163827 CGCGCGCGGGCAGCGCCCGCAGG - Intronic
1073503955 10:103967461-103967483 CGGGCAGGTGCCGCTCCCGGAGG + Exonic
1074772274 10:116742074-116742096 CGCGCGGGGGCTGCACACGCGGG + Intronic
1076807320 10:132865484-132865506 CAAACAGGTGCAGCGCCCGCCGG + Intronic
1076814320 10:132907143-132907165 CCGGCAGGTGCTGCCCACGCTGG + Intronic
1077105994 11:842909-842931 GGCGCAGGTACTGCGCCTGGGGG + Intronic
1077240689 11:1508884-1508906 CGGGCAGGGGCTGCTCCTGCAGG + Intergenic
1082817061 11:57515805-57515827 CGCGCACGTGACTCGCCCGCTGG + Intergenic
1083811653 11:65109917-65109939 CGTGCAGGTGCTGCCCAGGCTGG + Exonic
1084285556 11:68128475-68128497 CGGGCAGGGGCGGGGCCCGCGGG + Intergenic
1092793828 12:12091674-12091696 CTCCCAGGTGCTTCGCCCTCTGG - Intronic
1094199326 12:27780474-27780496 CGCGCAGCTGCTGCACCTCCGGG - Exonic
1094851637 12:34384888-34384910 CGCGCATGTGCAGAGCCCACGGG - Intergenic
1097029384 12:56080401-56080423 CTCCCAGGTGCCGAGCCCGCCGG - Intronic
1098029056 12:66235433-66235455 CGCGGAGCTGCAGCCCCCGCCGG - Intronic
1100315437 12:93441374-93441396 CGCGGAGGTGCGGCAACCGCGGG - Intronic
1102025795 12:109713873-109713895 CGCGGAGAGGCTGCGCGCGCCGG + Intergenic
1104920329 12:132287241-132287263 CGCCCAGGCGCTGTGCCTGCGGG + Intronic
1104949669 12:132433764-132433786 AGGGCAGGTGCTTCCCCCGCGGG + Intergenic
1105044042 12:132986794-132986816 CCCGCGGGTCCTGCCCCCGCAGG + Exonic
1105325887 13:19370470-19370492 CTCACAGGTGCGGCTCCCGCAGG - Intergenic
1105867620 13:24474624-24474646 CTCACAGGTGCGGCTCCCGCAGG + Intronic
1106057794 13:26254511-26254533 CGGGCTGGTGCTGCGGCCGGCGG + Exonic
1113562299 13:111291437-111291459 CGCGCTGGAGCTTAGCCCGCAGG - Intronic
1117377429 14:55129247-55129269 CGAGGAGGTGCTGCGGGCGCCGG - Exonic
1122162160 14:99792939-99792961 CGCGCTGTTCCCGCGCCCGCGGG - Intronic
1122542782 14:102507280-102507302 CGAGCTGCTGCTGCGCCAGCTGG - Exonic
1202834433 14_GL000009v2_random:67367-67389 GGAGCAGGTGCTGCGGCTGCTGG - Intergenic
1128314485 15:66652084-66652106 CGCCCAGGTGCTGAGGCAGCAGG + Intronic
1128654880 15:69453186-69453208 CGGGCAGGTCCTGGGCCCCCGGG + Intronic
1130371105 15:83285477-83285499 CGCGGAGGGGCTGAGGCCGCAGG + Intergenic
1132750878 16:1457088-1457110 CGGGCAGGGACTGTGCCCGCTGG + Intronic
1133040883 16:3059246-3059268 CGCGCAGGGGCGGCGGCGGCGGG + Exonic
1133732564 16:8589685-8589707 CCAGCAGGTCCTGCGCCCCCGGG + Exonic
1136364962 16:29805777-29805799 GGCGCAGGTGGTGGGCGCGCGGG - Intergenic
1137581565 16:49636670-49636692 CCCGCAGGTGCTTCTCCAGCAGG + Exonic
1142763695 17:2054939-2054961 CGCACAGATGCTGAGCCCGCGGG - Intronic
1144775305 17:17782155-17782177 CGCGCAGGGGCGGGGGCCGCGGG + Intronic
1144828441 17:18119372-18119394 CGCGTAGATGCTGCGGCTGCGGG - Exonic
1148156962 17:45430084-45430106 CGCGCACGTACTGCGCAGGCAGG + Intronic
1149491179 17:57085942-57085964 CTCCCAGGGGCTGCGCCGGCGGG - Exonic
1150388667 17:64778859-64778881 CGCGCACGTACTGCGCGGGCAGG + Intergenic
1150413391 17:64966022-64966044 TTCGCAGCTGCTGTGCCCGCTGG + Intergenic
1150790791 17:68199094-68199116 CGCGCACGTACTGCGCGGGCAGG - Intergenic
1150798426 17:68259195-68259217 TTCGCAGCTGCTGGGCCCGCCGG - Exonic
1151745033 17:76007381-76007403 CGGTCAGGTGCTGCACCTGCAGG + Exonic
1152133665 17:78491864-78491886 TGCACAGGTGCTGCGCCCCGTGG - Intronic
1152781462 17:82228949-82228971 CGCGCAGGGGCGGCGCCAGGCGG + Intronic
1152809473 17:82374771-82374793 CGCTGCGGTGCTGCGGCCGCTGG + Exonic
1153805220 18:8705080-8705102 CGCGCAGGTCCCGCCCCTGCCGG + Intergenic
1153900418 18:9613934-9613956 CGCGCCACTGCTGAGCCCGCAGG + Intronic
1160224325 18:77000623-77000645 TGCGCAGGAGCTCCGCCTGCTGG - Intronic
1161752835 19:6110259-6110281 CGTCCGGGTGGTGCGCCCGCGGG - Intronic
1162904969 19:13817936-13817958 GGTGCAGGTGCTGCGCAAGCAGG + Exonic
1162954465 19:14090530-14090552 CGCCGAGGCGCTGCGCCCCCCGG - Exonic
1165080065 19:33301940-33301962 GGCGCCGGCGCTGCGGCCGCTGG - Exonic
1165433838 19:35786466-35786488 CCAGCAGGTGCTGGGCCCACAGG - Intronic
1166547121 19:43640128-43640150 GGCCCAGGTGCTGCGCGCGAGGG + Intergenic
1167363911 19:49044762-49044784 CGGGCAGGTGCTGCCACCTCAGG + Intronic
1167365872 19:49054801-49054823 CGGGCAGGTGCTGCCACCTCAGG - Intronic
1167565010 19:50250628-50250650 CCCGCAGGTGCCTCGGCCGCTGG - Exonic
1167709933 19:51104347-51104369 GGCGCACGTGCTGCGCGCGCTGG - Exonic
1167781001 19:51598744-51598766 GGCACACGTGCTGCGCACGCTGG + Intergenic
934176957 2:89584987-89585009 GGAGGAGGTGCTGTGCCCGCTGG + Intergenic
934287264 2:91659347-91659369 GGAGGAGGTGCTGTGCCCGCTGG + Intergenic
935775121 2:106466287-106466309 CGCTCTGTTGCGGCGCCCGCCGG - Intronic
941020972 2:160407674-160407696 CGCGGAGCTGCAGCCCCCGCCGG - Intronic
947399056 2:229714372-229714394 TGCGCAGCTGCTGCCCGCGCTGG - Exonic
947915309 2:233828722-233828744 CGCGCAGGGACAGCACCCGCAGG - Exonic
948479339 2:238240238-238240260 CGCCCCGGTGCCGCCCCCGCGGG - Intronic
1169832466 20:9839191-9839213 CGTGCAGGAGCTGCCCCCGCCGG - Intergenic
1174504785 20:51010191-51010213 GGCGCAGCGGCTGCGGCCGCAGG - Exonic
1174806455 20:53608124-53608146 CGGGCAGGTTCTGCGGCCGCGGG - Intronic
1178922413 21:36747550-36747572 CGCCCACGCGCTGCACCCGCGGG - Intronic
1180215654 21:46322503-46322525 CGAGCAGGGGCTGCACCCACAGG - Intronic
1181162029 22:20965073-20965095 CGGGGCGGTGCTGGGCCCGCGGG + Intergenic
1181652975 22:24271081-24271103 GGCGCAGGCGCTGGGCCTGCCGG - Intronic
1184835598 22:47019216-47019238 CGAGCAGGTGCTGGGACCGCTGG - Intronic
949548879 3:5096164-5096186 CGCGCAGGCGCGGAGCCCACGGG + Intergenic
952926798 3:38326367-38326389 CCCACAGGTGCTGCTCCTGCAGG - Intergenic
961012924 3:123448156-123448178 CGCCCGGGTGCTGCCCCCGCTGG + Exonic
963733207 3:148991934-148991956 GCCGCAGCTGCTCCGCCCGCCGG - Intronic
964246209 3:154656863-154656885 TGTGCAGGTGCTGCACCCTCAGG + Intergenic
968481717 4:835985-836007 CGCGGAGGCGCTGTGTCCGCAGG + Intergenic
968693658 4:2009472-2009494 CGTGCAGGTGCTGGGCCCGCGGG - Exonic
969592387 4:8129370-8129392 CGCGCAGGGGCCGCGCAAGCTGG - Intronic
976146199 4:82044450-82044472 CGCCAAGGCGCTGCGCCCGCCGG - Intergenic
980930343 4:139177676-139177698 CGTGCACCTGCAGCGCCCGCCGG + Intergenic
982067338 4:151665938-151665960 AGCTCAGGGGCTGCGCCAGCGGG - Intergenic
985630060 5:1009394-1009416 AGCGAAGGCGCAGCGCCCGCGGG + Intronic
990210545 5:53478918-53478940 GGTGCAGGTGCGGCGGCCGCGGG + Intergenic
992105886 5:73448573-73448595 CGCGCGGATGCTGCGCTCCCTGG + Intergenic
999768149 5:154755982-154756004 CGGGCAGCTGCAGCGGCCGCGGG - Intronic
1002419424 5:179137917-179137939 CGAGCAGGTGCGGCCCCCGTTGG + Exonic
1006094523 6:31647609-31647631 GGGGCAGGTGTTGGGCCCGCTGG + Exonic
1006749738 6:36369404-36369426 AGGGCAGGTGCTGGGCCCACAGG + Intronic
1008952108 6:57172499-57172521 AGGGCAGGCGCGGCGCCCGCGGG - Exonic
1016958372 6:149648628-149648650 CGAGCAGGAGCCGCGCCGGCAGG - Exonic
1018876638 6:167827245-167827267 CGCGCAGGCCCCGCGCCCGGCGG - Intronic
1019197132 6:170289492-170289514 CGCGCAGGTGCGGCACTCACCGG + Exonic
1019198486 6:170296074-170296096 CCCGCCGGTGCTCCGGCCGCAGG - Intronic
1021983677 7:26079136-26079158 CGCGCATGCCCTGTGCCCGCGGG + Intergenic
1022095702 7:27139712-27139734 CGCGCAATTGCTGGGCCGGCCGG - Intronic
1023838688 7:44082998-44083020 CGTGTCGGTCCTGCGCCCGCCGG - Intergenic
1029494451 7:100889602-100889624 CGCGCCGGTCCTGCGGCAGCTGG - Exonic
1029832993 7:103280381-103280403 GGCGGGGGTGCTGCGCGCGCTGG - Intergenic
1032119238 7:129144724-129144746 CGGGCTGGTCCTGCGGCCGCGGG + Intergenic
1035266003 7:157690617-157690639 CCCGCAGCTGCTGCGCCCCGAGG - Intronic
1035418013 7:158705333-158705355 TGGGCAGGTGCTTCCCCCGCAGG + Intergenic
1047673464 8:127173821-127173843 CTCGCAGGTGCTGACCCTGCAGG - Intergenic
1049616461 8:143577724-143577746 CCCGCAGGTGCCGCTCCTGCAGG - Exonic
1049747973 8:144271006-144271028 CCCGCAGGTGCTGCGCTGGGCGG - Intronic
1051079680 9:13279631-13279653 GGCGCAAGTGCGGCGCGCGCTGG - Intergenic
1057171109 9:92963759-92963781 GGGGCAGGTGCTGGGCCTGCTGG + Intronic
1061411788 9:130425827-130425849 CCCGCAGGTGCTGCACCAGCTGG - Exonic
1061836235 9:133331964-133331986 TGCGCAGGTTCTGCCGCCGCCGG + Exonic
1185643603 X:1601407-1601429 CGGGCTCGTGCTGCGCCGGCGGG - Exonic
1197753226 X:129979841-129979863 GGGGCTGGGGCTGCGCCCGCGGG + Intergenic