ID: 912776540

View in Genome Browser
Species Human (GRCh38)
Location 1:112509272-112509294
Sequence GCAGCTTCCTCCGCACCACC CGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 227
Summary {0: 1, 1: 0, 2: 1, 3: 16, 4: 209}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
912776540_912776541 -7 Left 912776540 1:112509272-112509294 CCGGGTGGTGCGGAGGAAGCTGC 0: 1
1: 0
2: 1
3: 16
4: 209
Right 912776541 1:112509288-112509310 AAGCTGCGCAGCTCCCGCTTCGG 0: 1
1: 0
2: 0
3: 6
4: 73
912776540_912776544 9 Left 912776540 1:112509272-112509294 CCGGGTGGTGCGGAGGAAGCTGC 0: 1
1: 0
2: 1
3: 16
4: 209
Right 912776544 1:112509304-112509326 GCTTCGGCGCGCCAGCGCCCCGG 0: 1
1: 0
2: 0
3: 5
4: 59
912776540_912776549 30 Left 912776540 1:112509272-112509294 CCGGGTGGTGCGGAGGAAGCTGC 0: 1
1: 0
2: 1
3: 16
4: 209
Right 912776549 1:112509325-112509347 GGTCCCTGTGCCGTCGCCCGCGG 0: 1
1: 0
2: 0
3: 9
4: 76

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
912776540 Original CRISPR GCAGCTTCCTCCGCACCACC CGG (reversed) Exonic
900105176 1:978082-978104 GCCGCTTCCCCCGCAACCCCGGG + Intronic
900410842 1:2511907-2511929 GCAGCTGCCTCTGTCCCACCTGG - Intronic
900974483 1:6008544-6008566 GCAACTTCCACCACGCCACCCGG - Intronic
901447970 1:9319644-9319666 GCAGCATCCTCTGCACCAGCCGG - Intronic
901537417 1:9891541-9891563 GCAGCCCCCTCCTCACCACCCGG + Intronic
901857198 1:12052244-12052266 GCTGCTTACTCAGCACCAACAGG - Intergenic
903986685 1:27234261-27234283 GCACCTCCCACCCCACCACCGGG - Intergenic
905340547 1:37274656-37274678 GCAGCTTCCGCCCCACCCTCCGG - Intergenic
905913369 1:41668990-41669012 GAAGCTTCCTCTGCACTCCCAGG - Intronic
907358538 1:53896015-53896037 GCTGCTTCCTGCTCAGCACCTGG + Intronic
908823673 1:68113671-68113693 GCAGCTGCATCAGCACCTCCAGG + Intronic
910367370 1:86480545-86480567 GCAGCTTCAACCTCACCCCCAGG - Intronic
910839123 1:91545352-91545374 GCAGCCTCATCCTCAGCACCAGG + Intergenic
911123956 1:94322983-94323005 GCAGTCTCCTCCCCACCTCCAGG + Intergenic
912776540 1:112509272-112509294 GCAGCTTCCTCCGCACCACCCGG - Exonic
918354127 1:183689857-183689879 GCAGTTTCCCCCACAGCACCTGG - Intronic
920878500 1:209859026-209859048 GCCGCTCCCTCCACACCTCCCGG + Intergenic
1062972312 10:1658598-1658620 GGAGCTTCCCCTGCACCACTGGG - Intronic
1063946233 10:11178974-11178996 GCCACTTCCTCCACACCCCCAGG + Intronic
1065845231 10:29737470-29737492 GCGGCTGCCTCAGCATCACCTGG - Intergenic
1066061767 10:31730242-31730264 GCAGATTCCTGAGCACCACCAGG - Intergenic
1067797377 10:49330556-49330578 GCAGCAGCCTCCACATCACCAGG + Intergenic
1069758034 10:70785672-70785694 CCAGCTTCGTCAGCCCCACCTGG + Intergenic
1070587768 10:77779769-77779791 GCAGCTTCCTCCCCAGGGCCAGG + Intergenic
1073571255 10:104582825-104582847 GCAGCTGCCTCAGCAACTCCTGG - Intergenic
1074418732 10:113290339-113290361 CCAGGTTCCTCCTCAACACCTGG + Intergenic
1076809006 10:132877070-132877092 CCGGCATCCTCCCCACCACCAGG + Intronic
1077282648 11:1752649-1752671 GCAGCTGACTCGGCAGCACCGGG - Intronic
1077489785 11:2855430-2855452 GCAGCCTCCTGCCCACCCCCAGG - Intergenic
1078891295 11:15560908-15560930 GCCTCTCCCTCCGCACCTCCCGG - Intergenic
1081967926 11:47180595-47180617 GCAGCTTCTCCCGCACCTCCAGG + Exonic
1083609411 11:63998015-63998037 CCAGCTTCCTGCCCTCCACCGGG + Exonic
1084496708 11:69509498-69509520 GCAGCCACCTCCTCACCACTGGG + Intergenic
1089567620 11:119380394-119380416 GCAGCTTCCCCCAGGCCACCAGG + Intronic
1090796763 11:130142020-130142042 GCCTCTTCCTCAGCATCACCAGG - Exonic
1091748007 12:3004870-3004892 GCAGCTTCCTTCCTGCCACCAGG - Intronic
1092210254 12:6641244-6641266 TCAGCTTCCTCAGCACTAGCAGG + Intronic
1092354818 12:7786048-7786070 CCAGCATCCTCAGCACCACTTGG - Intergenic
1092367301 12:7887418-7887440 CCAGCATCCTCAGCACCACCTGG - Intronic
1096188628 12:49600163-49600185 ACAGCTGCCTCCGCATCTCCCGG + Exonic
1096517583 12:52165633-52165655 GCAGCCTCCTCCCCTCCTCCAGG + Intergenic
1097402219 12:59142762-59142784 GCAGCTTCAGCCCCACCAGCAGG + Intergenic
1100608276 12:96169712-96169734 CCAGCTTCCTCTCCACCACCTGG - Intergenic
1101603810 12:106233017-106233039 GCCTCTCCCTCCGCACCTCCCGG - Intergenic
1101640655 12:106583906-106583928 GCGGATTCCCCCGGACCACCGGG - Intronic
1101803408 12:108042413-108042435 GCAGCTGACCCCGCCCCACCAGG - Intergenic
1102381220 12:112468368-112468390 GGCGCTTCCTCCCCAGCACCAGG - Intronic
1104182040 12:126391031-126391053 GCAGGATCCTCAGGACCACCTGG - Intergenic
1104747074 12:131217224-131217246 GCAGCGTCCTCCCCTCCCCCAGG - Intergenic
1104829583 12:131740852-131740874 GCAGCTGCCTCCACACCCCAGGG - Intronic
1105657247 13:22454814-22454836 CCGGCTTCCTCCTCACCAGCAGG + Intergenic
1105855291 13:24366359-24366381 CCTGTTTCCGCCGCACCACCAGG + Intergenic
1110741966 13:79008188-79008210 CCAGCGTCTTCCTCACCACCTGG + Intergenic
1111445791 13:88345326-88345348 GCCCCCTCCTCCGCAGCACCCGG - Intergenic
1111860307 13:93696696-93696718 GCTGCAACCTCCGCCCCACCGGG + Intronic
1113788086 13:113013390-113013412 GCTGCTTCCCCCCCAACACCAGG + Intronic
1113803903 13:113102410-113102432 GCTGCTCCCTCCACCCCACCCGG - Intergenic
1114051457 14:18921937-18921959 GCAGGTTCCTCCCCATCCCCAGG - Intergenic
1114111104 14:19479987-19480009 GCAGGTTCCTCCCCATCCCCAGG + Intergenic
1115139000 14:30145988-30146010 GCAGCTGCATCCTCAGCACCTGG + Intronic
1122277990 14:100605059-100605081 GCAGCTTCCACAGCCTCACCCGG - Intergenic
1122307563 14:100775626-100775648 GAAGCTTCCTTCCCACCTCCTGG + Intergenic
1122554210 14:102568312-102568334 GCCTCTTCCTCTGCACCTCCAGG + Intergenic
1122876192 14:104666429-104666451 GCATCTTCCCCGGCACCCCCTGG + Intergenic
1122998738 14:105280503-105280525 GCAGCTTCCACCACACACCCAGG - Intronic
1125023082 15:35004497-35004519 GCAACTTCCACCTCACCTCCCGG + Intergenic
1128681507 15:69655803-69655825 GCAGCCTCCTGCCCACCCCCGGG + Intergenic
1128788020 15:70412584-70412606 GCAGATTCCTGGGCCCCACCTGG - Intergenic
1132348488 15:101122572-101122594 GCAGCTTCTTCAGTCCCACCTGG - Intergenic
1132367584 15:101268686-101268708 ACAGCATCCTCGGCACCCCCAGG + Intergenic
1132398587 15:101490940-101490962 GCAGCTTCCTTCCCACCTCAAGG - Intronic
1132659027 16:1053436-1053458 GCAGCCTCCTCAGCAACAGCTGG + Intergenic
1133129225 16:3665905-3665927 CCAGCTTCCTCAGCAGCCCCAGG + Intronic
1133808936 16:9146448-9146470 GCAGCCTCCTCAGCTCCTCCAGG + Intergenic
1135269218 16:21054471-21054493 TCAGCTTCCCTCGCACCAGCTGG + Exonic
1136390848 16:29963256-29963278 GCAGCTTCCTCCTCACCCACAGG + Exonic
1138520874 16:57570246-57570268 AGAGCTTCCTCCAAACCACCAGG + Intronic
1140033281 16:71355169-71355191 GCAGCTCCCTCTGCCCTACCAGG - Intergenic
1141641286 16:85343021-85343043 GCTGCTCCCTCTGCACCCCCAGG - Intergenic
1141996792 16:87641067-87641089 GCAGCTGACTCGGAACCACCCGG - Intronic
1142004876 16:87684943-87684965 GAAGCTTCCTCTGCACCAGGAGG + Intronic
1142232068 16:88904669-88904691 ACAGCTGCCCCCGCACAACCCGG - Intronic
1142641230 17:1286981-1287003 CCAGCATCCTCCTCACCACCTGG - Intronic
1143110059 17:4548103-4548125 GCAGCGTCCTGCCCACCCCCTGG + Intronic
1143659514 17:8315916-8315938 CCAGCTTCCTCCCCACCCCTGGG - Intronic
1144610515 17:16709081-16709103 GCATCTTCTTCCTCACAACCAGG - Exonic
1144902229 17:18606312-18606334 GCATCTTCTTCCTCACAACCAGG + Intergenic
1144928835 17:18839640-18839662 GCATCTTCTTCCTCACAACCAGG - Intergenic
1145130271 17:20339765-20339787 GCATCTTCTTCCTCACAACCAGG - Intergenic
1145270082 17:21400212-21400234 GGAGCTTGCTCCCCACCCCCAGG - Intronic
1146079133 17:29761376-29761398 GCGGCTGCCTCCGCGCGACCCGG - Intronic
1147449237 17:40493635-40493657 GCAGCTTCCTCAGGACCCTCTGG + Intronic
1148816786 17:50333666-50333688 GCAGCTTCCTCCAAACCTTCAGG - Intergenic
1149548857 17:57524931-57524953 GCAGCTGCATCAGCATCACCTGG + Intronic
1149687749 17:58547138-58547160 CCAGCATCATCAGCACCACCTGG + Intergenic
1151305748 17:73261828-73261850 GCAGCTTCCGCAGCCCCAGCAGG - Exonic
1151498391 17:74473433-74473455 GCTGCCTCCTCCACACCCCCAGG + Intronic
1151525009 17:74659083-74659105 CCACCTTCCTCCTCACCTCCAGG + Intergenic
1152446449 17:80347423-80347445 GCATCTTCCTGCTCTCCACCCGG - Exonic
1152572780 17:81127850-81127872 GCAGCTCCTTCACCACCACCTGG + Exonic
1152597717 17:81246070-81246092 GCTGCTCCTTCCGCCCCACCGGG + Exonic
1152686572 17:81696612-81696634 CCAGCTGCCTCTGCACCTCCAGG - Exonic
1154200176 18:12294092-12294114 GCGTCTTCCTCTGCAACACCGGG - Intergenic
1157856580 18:51110318-51110340 CCAGCTCCCTCCGCCCCACAAGG - Intergenic
1158351061 18:56565064-56565086 GCAGCTTCCTCTTCAGCAGCTGG - Intergenic
1165119393 19:33549376-33549398 GCATGTTCCTCCACACCTCCAGG + Intergenic
1167499275 19:49836291-49836313 GCTGCTGCCTCCGCCGCACCAGG + Exonic
926052735 2:9755141-9755163 GCTGCTTCCTCCGAACCTTCTGG - Intergenic
927385536 2:22529364-22529386 GCAGCCTCCGCCTCACCTCCTGG + Intergenic
928101085 2:28437677-28437699 GCAGGTTCCTACCCACCACGTGG + Intergenic
930011508 2:46941339-46941361 GCAGCTCCCAGCGCACCGCCCGG - Exonic
930974928 2:57446121-57446143 TCATTTTCCTCAGCACCACCAGG - Intergenic
931103093 2:59024702-59024724 GCAGCTGCTTCAGCATCACCTGG - Intergenic
932631393 2:73346269-73346291 CCAGCTACCTCAGCATCACCTGG + Intergenic
934497554 2:94821489-94821511 GCATCTTCCTCCTCACAATCAGG + Intergenic
934984258 2:98872720-98872742 GCAGCATCGTCAGCATCACCTGG - Intronic
937904866 2:127048184-127048206 GAAGCTTCGGCCGCGCCACCCGG - Exonic
938092550 2:128442943-128442965 GCCTCTTCCTCTGCACCCCCAGG - Intergenic
940235588 2:151507944-151507966 GCATCTTCCTCAGCACCCCTAGG + Intronic
940894174 2:159064508-159064530 CCACCTTCCTCCCCTCCACCAGG - Intronic
944592636 2:201232247-201232269 GCAGCTTCCTGCTCACCAGCCGG - Intergenic
945439769 2:209864698-209864720 GCAGCTTCCCTGGCACCAACAGG + Intronic
946020157 2:216634926-216634948 ACAGCTTCCTCCCGACCACTGGG - Intronic
946456467 2:219830637-219830659 GCAGCAGCATCAGCACCACCTGG + Intergenic
948704321 2:239779639-239779661 GCTGCTGCCTCCAGACCACCAGG - Intronic
1169200509 20:3706927-3706949 GCAGCTTCCTGCCCAGCTCCTGG + Intronic
1171770640 20:29319995-29320017 CCAGCTTCCTCGGCATCACCTGG + Intergenic
1172032211 20:31990083-31990105 GCTGGCTCCTCCTCACCACCAGG - Intronic
1172872987 20:38147337-38147359 GCAGCTTCCTCTGCACCCACGGG + Intronic
1173594337 20:44248801-44248823 CCAGCTTCATCAGCATCACCTGG - Intronic
1174282305 20:49448055-49448077 TCAGCTTCCTCAGAACCACAGGG - Intronic
1174414248 20:50356682-50356704 GCAGCAGCCTCCGCAACAGCTGG - Intergenic
1175059112 20:56225598-56225620 ACAGCATCATCAGCACCACCTGG + Intergenic
1179950038 21:44704196-44704218 CCAGCTACCTCCCCACCCCCAGG - Intronic
1180469930 22:15644313-15644335 GCAGGTTCCTCCCCATCCCCAGG - Intergenic
1181949137 22:26541603-26541625 GCAGCACCCTCCGCACCGACAGG + Exonic
1182296816 22:29315020-29315042 GCCGCTACCTCCGGACCCCCGGG + Exonic
1182667157 22:31968234-31968256 GAAGCCTCCTCCTCACCAGCTGG + Intergenic
1182760838 22:32721205-32721227 GCAGCTGCCTGCCCACCACCGGG - Intronic
1184235934 22:43183056-43183078 GCTGCTGCTTCCGCACCTCCCGG + Exonic
1184698298 22:46151407-46151429 CCAGCTTCACCCGCACCACGCGG - Intronic
1185203840 22:49525453-49525475 GCAGCTGCCTCCCCAGCACATGG - Intronic
950967774 3:17157874-17157896 GCAGCTTCCTTAGCAACCCCAGG + Intronic
951578245 3:24135083-24135105 GCAGCTTCATCAGCACACCCTGG - Intronic
954429581 3:50463274-50463296 GGAGCTTCTTCCTTACCACCTGG - Intronic
959452751 3:106523432-106523454 CCAGATTCCTCAGAACCACCAGG - Intergenic
966134847 3:176686520-176686542 TCTGCTTCCTCTCCACCACCAGG + Intergenic
968603805 4:1522146-1522168 ACAGCTTCCTCCTCACCTCAGGG - Intergenic
968819941 4:2843299-2843321 CCAGCCACCTCCGCACGACCAGG - Intergenic
968929653 4:3572076-3572098 GCAGCATCCCCCACACCTCCAGG - Intergenic
975850759 4:78569710-78569732 GCAGCTGCATCAGCATCACCCGG - Intronic
977304262 4:95303204-95303226 GCAGCTTCATCAGTATCACCTGG + Intronic
979828254 4:125267289-125267311 AAAGCTCCCTCCACACCACCTGG + Intergenic
980820366 4:138008715-138008737 GCAGCTTCCTCCCTACCTGCTGG + Intergenic
982758300 4:159250908-159250930 GCATCTCCCTCCACACCTCCCGG - Intronic
983604938 4:169572641-169572663 GCAAGTTCCTCCTCACCTCCAGG - Intronic
984772195 4:183445267-183445289 GCAGCTGCGCCCACACCACCGGG - Intronic
985702057 5:1379431-1379453 CCGGCTTCCCCCGCACCACACGG + Intergenic
988484370 5:31656318-31656340 GCAGCCTCCCCCGGAACACCTGG + Intronic
991692033 5:69234820-69234842 GCAGCTTCCTCCGCCCACCACGG + Intronic
993837660 5:92835143-92835165 CCAGTTTCCCCAGCACCACCAGG + Intergenic
996004644 5:118405625-118405647 CCAGCTTCCCCAGCACCAGCAGG + Intergenic
997721048 5:136078764-136078786 GCGGGTTCCTGCGCACCACCCGG + Intergenic
997786211 5:136716247-136716269 GCTGCTGCCTCAGCACCACTAGG - Intergenic
999418399 5:151419703-151419725 CCAGCTGCATCAGCACCACCTGG - Intergenic
1002925131 6:1601636-1601658 GCACCTTCCTGCGCACGACGGGG + Intergenic
1003065782 6:2902907-2902929 GCAGCCTCCTCCCCACCTGCCGG - Intronic
1003086389 6:3064332-3064354 GCAGCCTCCTCCCCACCTGCCGG + Intronic
1003234237 6:4281726-4281748 GCAGCTCCCTGAGAACCACCTGG - Intergenic
1006572579 6:35017823-35017845 TCTCCTTCCTCAGCACCACCAGG - Exonic
1007414234 6:41682821-41682843 CCAGGTTCCACCCCACCACCTGG - Intergenic
1007508675 6:42358475-42358497 GCAGCTAACTCCACATCACCAGG + Intronic
1008506608 6:52237020-52237042 GGTGCTTCCTCCGGACGACCAGG + Exonic
1008617884 6:53243692-53243714 CCAGCAGCCTCAGCACCACCTGG - Intergenic
1009975560 6:70667736-70667758 GTTCCTTCCTCCGCGCCACCCGG + Intergenic
1010198014 6:73259079-73259101 GCTTCTTCCTACTCACCACCAGG + Intronic
1015809787 6:137150316-137150338 TCAGCTGCCTCCTCACCCCCAGG - Intronic
1016013211 6:139159598-139159620 GCAGCTGCCTCCCCAGCAGCTGG + Intronic
1016461175 6:144281552-144281574 GCAGCTTCCTGGGCCCCACCAGG + Intergenic
1017275986 6:152569100-152569122 GCAGCAGCATCAGCACCACCTGG + Intronic
1018846629 6:167561341-167561363 GCAACTTGCTCTGCCCCACCGGG - Intergenic
1019328136 7:449417-449439 GCAGCTACTTCCGCACCTGCAGG + Intergenic
1022228601 7:28390591-28390613 TCTTCTTCCTCCGCACCACTTGG + Intronic
1026000733 7:66557809-66557831 ACAGCTTCCTCCCCTCAACCAGG + Intergenic
1033469698 7:141634176-141634198 GCAGCTTCCTCAACACTAGCTGG + Intronic
1033791545 7:144797047-144797069 CCAGATTCCTCAGCACCAGCAGG - Intronic
1034415917 7:150964144-150964166 GCAGCCTCTTCCTCCCCACCTGG - Intronic
1034786973 7:153935092-153935114 TCAGCTTCCTCAGCACCCACTGG - Intronic
1035295105 7:157862798-157862820 GCCGCTTCCCGCACACCACCAGG - Intronic
1035638527 8:1164536-1164558 GCAGCATCCGTGGCACCACCGGG - Intergenic
1036774057 8:11597971-11597993 GCAGCTTCCTGGGCACGTCCAGG - Intergenic
1038779093 8:30555897-30555919 GCAGCTTGTTCCCCCCCACCGGG + Intronic
1039475055 8:37835340-37835362 TCCGCTTCCGCTGCACCACCGGG + Exonic
1039525292 8:38209157-38209179 TCAGCGCCCTCAGCACCACCCGG + Exonic
1040447342 8:47508763-47508785 GCAGCTTCCACCCCACCATCAGG + Intronic
1041792602 8:61714195-61714217 GCAGCGTCCGCCGCGCCAGCCGG + Intronic
1042680474 8:71378002-71378024 TCAGCTTCCTCTGAAACACCAGG + Intergenic
1043373482 8:79620905-79620927 TCAGCCTCATCAGCACCACCTGG - Intronic
1045441881 8:102221953-102221975 GCAGATTCCTCAGTCCCACCTGG + Intronic
1048251071 8:132867089-132867111 GGAGCTCCCTCCCCACCGCCTGG - Intronic
1049008869 8:139874356-139874378 GCAGCATCCTCAGCACCTGCGGG - Intronic
1049197872 8:141325423-141325445 GCAGCTTGCTCAGCAGCCCCAGG - Intergenic
1050720034 9:8577753-8577775 GCAGCAGCCTCTGCATCACCTGG + Intronic
1052369286 9:27645735-27645757 CCAGATTCCTCAGAACCACCAGG - Intergenic
1053659591 9:40258982-40259004 GCATCTTCCTCCTCACAATCAGG - Intronic
1053909963 9:42888334-42888356 GCATCTTCCTCCTCACAATCAGG - Intergenic
1054371719 9:64405281-64405303 GCATCTTCCTCCTCACAATCAGG - Intronic
1054460627 9:65460395-65460417 GCAGCATCCCCCACACCTCCAGG + Intergenic
1054525007 9:66117234-66117256 GCATCTTCCTCCTCACAATCAGG + Intronic
1054679338 9:67894998-67895020 GCATCTTCCTCCTCACAATCAGG - Intronic
1057448899 9:95138709-95138731 GCAGCTTCCCCACCACCACCTGG - Intronic
1058087079 9:100759455-100759477 GAAGCTGCCTCCACAGCACCGGG - Intergenic
1059290662 9:113221258-113221280 CCAGCTTCCTCCCCGCAACCCGG - Exonic
1059933337 9:119283241-119283263 TCAGCTGCCTCAGCATCACCTGG + Intronic
1060324853 9:122604305-122604327 GGTGCTTCCTCCTCTCCACCAGG - Intergenic
1061030459 9:128078964-128078986 ACGGCTTCCTGTGCACCACCAGG - Intronic
1061385167 9:130285354-130285376 CCAGCTTCCTCGGGACCCCCGGG - Intronic
1061660646 9:132127979-132128001 TCGGCTTCCCCCGCCCCACCCGG - Intergenic
1062163445 9:135092895-135092917 TCAGCTTCCCCCGCACACCCTGG + Intronic
1062339505 9:136087695-136087717 CCAGCTTCCACCGCAGCACGGGG + Intronic
1062489909 9:136799998-136800020 GCAGCTTCTCCCGCACCACCTGG - Exonic
1185890315 X:3816358-3816380 GGAGCTTCCCCCGCAGCCCCGGG - Intergenic
1186450955 X:9673265-9673287 TCAGTTCCCTCCCCACCACCTGG + Intronic
1192590614 X:72356652-72356674 GCAGCTTCCACCTCCCCTCCCGG + Intronic
1196057329 X:111369756-111369778 GCACCCTCCTCCTCACCCCCTGG - Intronic
1196860906 X:120026161-120026183 GCATCTCCCTCCACACCTCCAGG + Intergenic
1200237889 X:154477970-154477992 GCTGCATGGTCCGCACCACCAGG + Exonic