ID: 912776541

View in Genome Browser
Species Human (GRCh38)
Location 1:112509288-112509310
Sequence AAGCTGCGCAGCTCCCGCTT CGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 80
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 73}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
912776540_912776541 -7 Left 912776540 1:112509272-112509294 CCGGGTGGTGCGGAGGAAGCTGC 0: 1
1: 0
2: 1
3: 16
4: 209
Right 912776541 1:112509288-112509310 AAGCTGCGCAGCTCCCGCTTCGG 0: 1
1: 0
2: 0
3: 6
4: 73

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
912776541 Original CRISPR AAGCTGCGCAGCTCCCGCTT CGG Exonic
901629807 1:10642592-10642614 GGGCTGCGCTGCTCCCGCTGTGG + Intronic
905690729 1:39940831-39940853 AAGCTGCGCAACGCCAGCCTTGG - Intergenic
912776541 1:112509288-112509310 AAGCTGCGCAGCTCCCGCTTCGG + Exonic
917679787 1:177354212-177354234 AAGCAGGGCGGCTCCTGCTTGGG + Intergenic
921199629 1:212792396-212792418 GAGATGCGCAGCGCCCGCCTCGG - Intronic
922857846 1:228790367-228790389 GAGCTGAGCAGCTCCAGCTGGGG + Intergenic
1073072849 10:100805785-100805807 GAGCAGCAAAGCTCCCGCTTGGG - Intronic
1074768182 10:116716028-116716050 CAGCTGAGCAGCTCCCACTCTGG + Intronic
1074893832 10:117757679-117757701 AAGCTGAGCAGCCCACACTTTGG - Intergenic
1075096870 10:119477736-119477758 AACCTGCCCAGCTCCCTCTCTGG - Intergenic
1083897104 11:65625430-65625452 AAGCTGCGCTCCTCCAGCTCAGG - Exonic
1092820583 12:12350194-12350216 ATGCTCCGCAGCTCCCGCACCGG + Exonic
1093371890 12:18375848-18375870 AAGGGGCGCAGGTACCGCTTGGG + Intronic
1095829604 12:46570037-46570059 AAGCTGCACTGCTCCGGATTGGG - Intergenic
1096459252 12:51813185-51813207 AAGATGTGCAGCTCCCCCTCGGG - Intergenic
1099684365 12:85866265-85866287 AATCTGCGCAGCTCCAGAGTTGG + Intergenic
1104560622 12:129840614-129840636 AGGCTGCGCAGCCCCCGCCCTGG - Intronic
1105257199 13:18751649-18751671 AAGATGCGCAGGTACAGCTTGGG - Intergenic
1107426966 13:40303780-40303802 AAGCACCGCAGATCCTGCTTTGG - Intergenic
1112429612 13:99339167-99339189 ATGCTGCGCAGCCCGAGCTTGGG - Intronic
1126560707 15:50040665-50040687 AAGCTGAGCAGCTCACTCTCGGG + Intronic
1132759510 16:1501939-1501961 AAGATGCGGAGCTCACGCCTCGG - Intronic
1132912380 16:2321135-2321157 GAGCTGAGCAGCTCCTGCCTGGG + Intronic
1132921296 16:2395880-2395902 GAGCTGGGCATCTCCAGCTTTGG + Intergenic
1135410255 16:22228751-22228773 AAGCTGGACAGCTCGAGCTTCGG + Intronic
1137783209 16:51115090-51115112 AAGCTATGAAGCTCCAGCTTTGG - Intergenic
1138137193 16:54533282-54533304 CAGCTGAGCAGCTCCCACTGTGG - Intergenic
1142173731 16:88635501-88635523 AACCTGCCCAGCTGCGGCTTGGG - Intergenic
1144806741 17:17972623-17972645 AAAATGCGCAGCTTCCCCTTTGG - Intergenic
1148216621 17:45836992-45837014 AAGCCCCGCAGCTCCTGCTGAGG + Intergenic
1150642782 17:66960863-66960885 AAACTGCGGAGCTCCCGTTGGGG + Intergenic
1151726901 17:75890703-75890725 GAGCTGCCCAGCTTCAGCTTGGG - Exonic
1152744326 17:82032005-82032027 ATGCTGCCCGGCTCCCGCTTGGG + Intronic
1163437752 19:17305481-17305503 CATCTGCCCAGCTCCCGCTGGGG + Intronic
925569882 2:5297891-5297913 ATGCTGCGCAGCTCTGGATTTGG - Intergenic
927139800 2:20122054-20122076 AAGCTGGAGAGCTCCCGCTAAGG - Intergenic
936460977 2:112713634-112713656 AACCTGCTCAGCTCCCACTGAGG - Intergenic
939811320 2:146836266-146836288 AAGGTGAGCAGCTCCAGCTGAGG + Intergenic
944977962 2:205079014-205079036 AAGCTGGGCAGCCCTCGCTTGGG - Intronic
948805436 2:240451890-240451912 AAGCTGCCCAGATCCTGCTTGGG - Intronic
948949894 2:241242620-241242642 AAGCTGCACAACTCCCTCATTGG - Exonic
1169057412 20:2635004-2635026 AAGCTCAGCTGCTCCAGCTTTGG - Intronic
1173144595 20:40513776-40513798 AAGCTCCGGAGCTCAGGCTTGGG - Intergenic
1176843187 21:13856699-13856721 AAGATGCACAGCTACAGCTTGGG - Intergenic
1176845875 21:13876045-13876067 AAGATGCACAGCTACAGCTTGGG - Intergenic
1176848610 21:13895600-13895622 AAGATGCACAGCTACAGCTTGGG - Intergenic
950521761 3:13501697-13501719 GAGCTGTGCAGCTCCAGCTGTGG - Intronic
953960612 3:47263250-47263272 CAGCTGAGCACCTCCAGCTTGGG - Intronic
962853753 3:139326771-139326793 AAGCTGAGCAGCTCCCCCAAGGG + Intronic
964831155 3:160885766-160885788 AATCTGCGCAGCTCCAGGGTTGG - Intronic
968534756 4:1116987-1117009 AAGCTCTCCAGCTCCCTCTTTGG + Intergenic
968867945 4:3225702-3225724 ATGCTCCCCAGCTCCCGCTCGGG - Exonic
969365553 4:6692303-6692325 GAGCTGGGCAGTTCCCTCTTGGG - Intergenic
971877701 4:32326345-32326367 AAGCTGGGCAGCCCCCACTCGGG + Intergenic
984935347 4:184884586-184884608 AGGCTGCTCACCTCCCGCTTGGG + Intergenic
989732383 5:44664356-44664378 CAGCTGCGCAGCCACCGCTCGGG + Intergenic
994910759 5:105903162-105903184 AAGCTGCGCTGCTACAGCTCCGG - Intergenic
995145917 5:108787078-108787100 CAGCTGCCCAGCTGCAGCTTGGG + Intronic
997228941 5:132228837-132228859 AGGCTGGGCATCTCCCGCTCTGG - Intronic
998071789 5:139203490-139203512 AAGCTGCTCAGGTGCTGCTTGGG - Intronic
1001156866 5:169280119-169280141 AAGCTGCCCAGCTTCCGCTGGGG + Intronic
1001664344 5:173420343-173420365 AAGCTGAGCAGCCCTCGCTCAGG + Intergenic
1005121100 6:22390035-22390057 AATCTGCGCAGCTCCAGGGTTGG + Intergenic
1016122025 6:140355653-140355675 AAGCTGCTCAGCTCCCAATTAGG - Intergenic
1019721851 7:2577134-2577156 AAGCTGCGTGGCTCCCACTCAGG - Intronic
1019820094 7:3236206-3236228 AAGCTGTCCAGCTTCTGCTTGGG + Intergenic
1020221007 7:6237113-6237135 AACCAGAGCAGCTCCCGCCTCGG + Intronic
1021390638 7:20088525-20088547 AGGCTGCTCATCTCCCACTTTGG - Intergenic
1021446469 7:20739057-20739079 CAGATGCGCAGCCCCCGATTTGG - Exonic
1033254245 7:139785819-139785841 AAGCTGTGCAGCTATTGCTTAGG - Intronic
1034272292 7:149809112-149809134 AGGCTGCGCAGCTGCTGCCTCGG - Intergenic
1035104378 7:156429772-156429794 CAGCTGTGCAGCTCCCAGTTAGG + Intergenic
1035247536 7:157573645-157573667 TAGCTGGTCAGCTCCTGCTTTGG + Intronic
1035438492 7:158877557-158877579 ATGATGCCCAGCTCCTGCTTAGG - Intronic
1042092342 8:65172539-65172561 AAGCTTTGCAGCTTCCACTTGGG - Intergenic
1054863589 9:69977268-69977290 AAGGTGCCCAGCTCCATCTTGGG - Intergenic
1056434531 9:86562732-86562754 ATGCTGCCCAGCTCTCCCTTAGG + Intergenic
1058569993 9:106331264-106331286 AAACTGGGGAGCTCCCGTTTAGG + Intergenic
1186682538 X:11891017-11891039 CAGCTGGGCAGCTGCCTCTTGGG + Intergenic
1196168934 X:112565837-112565859 AATCTTGGCAGCTCCAGCTTCGG - Intergenic