ID: 912776541

View in Genome Browser
Species Human (GRCh38)
Location 1:112509288-112509310
Sequence AAGCTGCGCAGCTCCCGCTT CGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 80
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 73}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
912776540_912776541 -7 Left 912776540 1:112509272-112509294 CCGGGTGGTGCGGAGGAAGCTGC 0: 1
1: 0
2: 1
3: 16
4: 209
Right 912776541 1:112509288-112509310 AAGCTGCGCAGCTCCCGCTTCGG 0: 1
1: 0
2: 0
3: 6
4: 73

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
912776541 Original CRISPR AAGCTGCGCAGCTCCCGCTT CGG Exonic