ID: 912777454

View in Genome Browser
Species Human (GRCh38)
Location 1:112514738-112514760
Sequence AGCTTTATGGAATGTGGGTT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 186
Summary {0: 1, 1: 0, 2: 1, 3: 13, 4: 171}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
912777454 Original CRISPR AGCTTTATGGAATGTGGGTT AGG Intronic
900690257 1:3976570-3976592 AGCTCTGGGGAATGTGGATTTGG + Intergenic
901221239 1:7585180-7585202 AGCTTTATGGATTTTGGAATTGG + Intronic
902647270 1:17808742-17808764 AGCTTTATGGGGTGAAGGTTTGG + Intronic
902916267 1:19641519-19641541 AGCTTTCTGCAATGTGGGAGTGG + Intronic
905175416 1:36132330-36132352 AGCTGAATGCAATGTGGGGTCGG - Intergenic
905878242 1:41447213-41447235 AGCTCTAGGGTATGGGGGTTGGG - Intergenic
909638944 1:77850324-77850346 AGCCCTATTCAATGTGGGTTGGG + Intronic
911157706 1:94653379-94653401 GGATTGATGGAAAGTGGGTTAGG - Intergenic
912115631 1:106403513-106403535 AGCTGTATGGACTGTGACTTGGG - Intergenic
912777454 1:112514738-112514760 AGCTTTATGGAATGTGGGTTAGG + Intronic
913153314 1:116067374-116067396 ACCACTTTGGAATGTGGGTTTGG - Exonic
917400234 1:174640426-174640448 AGCTTTTGGGAATATGGGATGGG - Intronic
920978525 1:210809149-210809171 AGCTATATGGAATTTGGCTGGGG + Intronic
923004904 1:230040645-230040667 AGTTTTGAGGAATATGGGTTAGG + Intergenic
923202561 1:231726251-231726273 AACATTATGGAATGTGGCTTGGG + Intronic
1065334389 10:24641466-24641488 AGATTATTGGAATTTGGGTTTGG - Intronic
1068473938 10:57501530-57501552 AGGGTTAGGGTATGTGGGTTGGG - Intergenic
1070440296 10:76436424-76436446 AGCCCTGTGGAATGTGGGCTGGG + Intronic
1072756286 10:98023314-98023336 AGCTAGATGGAAGGCGGGTTTGG + Intronic
1074315902 10:112361511-112361533 AATTTTATGGAAAGTGGCTTTGG - Intergenic
1075672760 10:124274364-124274386 AGTTTTATGGATTGTGATTTTGG + Intergenic
1077008786 11:370920-370942 AGCTGTGAGGTATGTGGGTTGGG - Intronic
1078107705 11:8368985-8369007 ATCTGTATGGAATGCCGGTTAGG + Intergenic
1079380400 11:19933061-19933083 AGCTATACGGCATTTGGGTTGGG + Intronic
1080826827 11:35855734-35855756 GGATTTATGGAAAATGGGTTAGG - Intergenic
1081514296 11:43810175-43810197 AGATTTTTGGTATCTGGGTTAGG - Intronic
1083490383 11:63011119-63011141 AGCCTCACGGATTGTGGGTTGGG + Intronic
1083775844 11:64894024-64894046 AGCTTTGTGCAGTGAGGGTTGGG + Intergenic
1085498977 11:77000439-77000461 AGTTTTATGGATTGTGTTTTTGG + Intronic
1087357667 11:97115586-97115608 AGCTTTCTAGAATTTTGGTTGGG - Intergenic
1087413623 11:97824452-97824474 ATCTTTATGGCACTTGGGTTGGG - Intergenic
1088111890 11:106271390-106271412 AGCTTGATGAAATGTGGGTTTGG + Intergenic
1088122351 11:106385281-106385303 TGCTTTATGTAATTTGTGTTAGG + Intergenic
1091059225 11:132445928-132445950 AGCTTTATTGTAGGTGGGTCAGG + Intronic
1092985608 12:13842626-13842648 AGCTTTTTGGAAAGTGGTCTAGG - Intronic
1096884701 12:54705365-54705387 AACTGTGTGTAATGTGGGTTTGG + Intergenic
1098040626 12:66350793-66350815 GGGTTTATCGAAGGTGGGTTGGG - Intronic
1100107895 12:91199667-91199689 AGCTTTATGGATGATGGATTAGG - Intergenic
1100390426 12:94141901-94141923 AGCTTGGAGAAATGTGGGTTGGG + Intergenic
1101761141 12:107660075-107660097 AGCATTATGGGATGGGGGTGGGG + Intergenic
1101770872 12:107749788-107749810 AGTTTTAGGGAGTGAGGGTTGGG - Intronic
1102762596 12:115401465-115401487 AGCTTTATGGTAATTGGCTTTGG + Intergenic
1105672018 13:22629645-22629667 AACTTTCTGGAAAGAGGGTTGGG - Intergenic
1108000506 13:45901736-45901758 AGCGTTTTGGAGTTTGGGTTTGG - Intergenic
1108114485 13:47111702-47111724 AACTTTAAGGAATGTGGAGTTGG + Intergenic
1112398535 13:99055581-99055603 AGGCATATGGAATGTGGATTGGG + Intronic
1114138018 14:19875360-19875382 AGCTTCATGGAATAGGGATTAGG - Intergenic
1114757760 14:25279559-25279581 AGCATGATGGAATTTGGGGTGGG + Intergenic
1115266268 14:31503844-31503866 ACCTTTAAGGAGTGTGGGGTGGG + Intronic
1117334732 14:54747378-54747400 AGGTTTAGGGAATGCGGGTATGG - Intronic
1119021494 14:71119943-71119965 AGCTTGGTGGAATGAGTGTTTGG + Intergenic
1120068492 14:80074870-80074892 GGCTTTGTGGAATGTGGATAGGG + Intergenic
1120732103 14:88015614-88015636 AGCTTGGTGGTATGTGGGCTGGG - Intergenic
1124042183 15:26115817-26115839 AGGTTGATGGCGTGTGGGTTGGG - Intergenic
1124411022 15:29437080-29437102 AGCTTCATGGACTTTGGTTTCGG - Intronic
1132898799 16:2242286-2242308 AGCTTTATGGACAGTGGGCCAGG - Intronic
1132953546 16:2578535-2578557 AGTTTTGTGGAATGAGGGTGGGG + Intronic
1132960806 16:2621632-2621654 AGTTTTGTGGAATGAGGGTGGGG - Intergenic
1134001031 16:10782979-10783001 ATTTTTTTGGAGTGTGGGTTTGG - Intronic
1135828689 16:25754279-25754301 AGCTGTATGGAGTGTGTGATTGG - Intronic
1140592213 16:76367386-76367408 TCCTTTATGGCATTTGGGTTTGG - Intronic
1141504127 16:84463446-84463468 AGCATTTTGGATTCTGGGTTAGG + Intronic
1144942038 17:18948545-18948567 AGCTTTGGGGAGGGTGGGTTTGG + Intergenic
1146413291 17:32608099-32608121 TGCTTTATGGATTGTGCTTTTGG - Intronic
1147800871 17:43086762-43086784 ATCCTTTTTGAATGTGGGTTTGG - Intronic
1148138411 17:45310670-45310692 AGCTTCGTGCACTGTGGGTTTGG + Intronic
1148498129 17:48067213-48067235 ATCTTTATGGACTGTGGCATTGG - Intergenic
1148866311 17:50630605-50630627 AGCTGTTTGGAAAGTGGGTGAGG - Intergenic
1149679605 17:58496151-58496173 AGCTTTGTGGACTCTGGGGTAGG - Exonic
1151190181 17:72392646-72392668 AGCTTTCTGAATCGTGGGTTGGG - Intergenic
1151449473 17:74189339-74189361 AGCTCAATGGAAGGTGAGTTAGG - Intergenic
1153861429 18:9213086-9213108 AGCTTTATGGGTTCTTGGTTTGG + Intronic
1166157948 19:40929089-40929111 AACTTTAAGGAATGTGGAGTTGG + Intergenic
925107564 2:1306121-1306143 AGGTTTATGGAAGGTGGGCAAGG + Intronic
925914819 2:8597306-8597328 AGGTGTATGTAATGTGGGTATGG + Intergenic
926155564 2:10451984-10452006 AGCTTTCTGGAAAATGGGTTTGG + Intergenic
928207201 2:29294067-29294089 AGCTTCATGGGATGTGGGGCAGG + Intronic
929185955 2:39094886-39094908 AGGTTTATGGCTTGTGGTTTTGG - Intronic
929745852 2:44657513-44657535 TGCTTTATGGTATGTAAGTTTGG + Intronic
930737048 2:54789944-54789966 AGCTTCATGGTATGTGTGTGTGG + Intronic
935281564 2:101522247-101522269 AGCTTTATGGAAAGCGGGGCTGG + Intergenic
942164363 2:173227776-173227798 ACCTTTATAGAAACTGGGTTGGG - Intronic
943168744 2:184368436-184368458 AGCTTGCTGGAATCTGGATTGGG - Intergenic
943840956 2:192579987-192580009 CATTTTATGGAATGTGCGTTGGG - Intergenic
948763461 2:240207654-240207676 AGCTTTCTGGGATGGGGGCTGGG - Intergenic
1169431807 20:5542961-5542983 AGCTTTATGTTATGTGTGTTAGG - Intergenic
1170302049 20:14895184-14895206 AGCTTAAAGGAATGTGTGTTGGG + Intronic
1170355097 20:15483584-15483606 AACTTGCTGGAATCTGGGTTGGG + Intronic
1170583300 20:17715173-17715195 AGCTTCATGGACTCTGGGTCTGG - Intronic
1172065711 20:32218772-32218794 AGCTTTTTGGAATTTGCTTTTGG - Intronic
1173629146 20:44497107-44497129 AGCCTTGGGGAATGCGGGTTGGG - Intronic
1175609444 20:60338464-60338486 GGCCTTATGGGATGTGGGATGGG - Intergenic
1177686878 21:24448359-24448381 AGCTTGGTGGAATTTTGGTTTGG + Intergenic
1183827206 22:40397825-40397847 AGCTCTTTAGAATATGGGTTAGG - Intronic
1184420444 22:44379721-44379743 AGCCTGCTGGAATTTGGGTTGGG - Intergenic
955189177 3:56744376-56744398 AGGTTTATTGAGTGTGGGCTGGG - Intronic
955870632 3:63434704-63434726 GGCTTTAAGAAATGTGTGTTAGG + Intronic
956143227 3:66166714-66166736 AGCCATATGGAATTAGGGTTGGG - Intronic
956508638 3:69970973-69970995 TGCTTTGAGGAATGGGGGTTTGG + Intergenic
956616050 3:71173839-71173861 AGCTTTAAGGAATGGGAGTTGGG + Intronic
957215460 3:77314835-77314857 TGCTGTAGGGAATGTGGGTAGGG + Intronic
961111919 3:124291611-124291633 AGATTTAAGGAATTTGGGTATGG + Intronic
961136905 3:124519926-124519948 ATCTTTCTGGAAAGTGGGATGGG - Intronic
961533533 3:127555204-127555226 AGCCTGATGGAATCTGGGGTTGG - Intergenic
961809752 3:129514957-129514979 GGGTTGAAGGAATGTGGGTTGGG - Intronic
962191487 3:133315525-133315547 CTCTTTATGGAATCTGTGTTTGG - Intronic
962605774 3:137031842-137031864 AGCTTTATCTAATCTGGGGTTGG - Intergenic
964712087 3:159682005-159682027 AGGTCTGTGGAATGTGGTTTGGG - Intronic
965235568 3:166115791-166115813 AATTTTATGGAATGTGCTTTTGG - Intergenic
966350200 3:179025457-179025479 AGCCATTTGGAATTTGGGTTTGG - Intronic
966449389 3:180040771-180040793 AGGTTTAGGGAATCTGGGCTAGG - Intergenic
971752613 4:30669982-30670004 TGCTTTATGGGATGTTGGTTTGG + Intergenic
973228591 4:47815899-47815921 CGCTAAATGAAATGTGGGTTTGG - Intronic
978566807 4:110091254-110091276 AGGTTGATGGAAGATGGGTTTGG + Intronic
979100304 4:116604222-116604244 AGCTTTTTTTAATCTGGGTTAGG + Intergenic
980019753 4:127694544-127694566 AGTTTCATGGATTGTGGTTTTGG + Intronic
981509567 4:145541032-145541054 AGCTGTTTGGGATGAGGGTTGGG + Intronic
981554832 4:145981425-145981447 AGATTGATGGAATGTGGGTGAGG - Intergenic
983247524 4:165305447-165305469 ATGTTTATGAAATGTTGGTTAGG + Intronic
986042359 5:4005804-4005826 GGCTTTAAGTAAAGTGGGTTTGG - Intergenic
987810201 5:22825334-22825356 AGATTTATTAAATGTGGGTTAGG + Intronic
989422928 5:41261052-41261074 AGTTTTATAGAATATGGTTTTGG - Intronic
991117370 5:62970022-62970044 TGCTTTAGGGAATGGGGGTGAGG - Intergenic
991359600 5:65805550-65805572 AGCTTCATAGAATGGGAGTTAGG - Intronic
991587066 5:68212435-68212457 ATTTTTTTGAAATGTGGGTTAGG - Intergenic
992627908 5:78650670-78650692 GGATTTGTGGGATGTGGGTTGGG - Intronic
993508246 5:88737906-88737928 AGCTTTATTAAATTTGTGTTAGG + Intronic
993562561 5:89428976-89428998 AGTTTTGAGCAATGTGGGTTAGG - Intergenic
993743858 5:91571681-91571703 AGGTTTTTGGAATTTGGGTAGGG + Intergenic
994188968 5:96846402-96846424 ATTGTTATGGAATGTGGGCTAGG - Intronic
994364820 5:98900822-98900844 AGATTTATGGATTGTCGGATTGG - Exonic
997421360 5:133769508-133769530 AGCTTTATGGGACGTGGGGCAGG - Intergenic
998701571 5:144708339-144708361 AGCTTGCTGGAATTTGGATTGGG - Intergenic
999961243 5:156757865-156757887 ACTTTGATGGATTGTGGGTTTGG - Intronic
1000413995 5:160964463-160964485 AGCTTGAGGGAATATGGGTAGGG - Intergenic
1000992029 5:167921056-167921078 AGATTTATGGACTGAGGCTTAGG + Intronic
1003168672 6:3703188-3703210 AGATCAAGGGAATGTGGGTTTGG + Intergenic
1004213131 6:13673031-13673053 AGCTTTCTGGATTTGGGGTTTGG - Intronic
1004440171 6:15642282-15642304 ATCTTTATGAAATGAAGGTTGGG + Intronic
1004675440 6:17837607-17837629 AGTTTTATGGAATGTTTATTTGG + Intronic
1005108554 6:22252558-22252580 ATCTTCATGGAGTGTGGGTTTGG + Intergenic
1006049333 6:31329341-31329363 AGCTTAATGGAAAGGTGGTTTGG - Intronic
1006241466 6:32683484-32683506 AGCTTTAGGGAATTTGGGTGTGG + Intergenic
1009861443 6:69339254-69339276 TGCTTTGTTGAATGGGGGTTTGG + Intronic
1010111102 6:72233844-72233866 AGTTTTCTGGAAAGTGTGTTTGG + Intronic
1012769531 6:103412901-103412923 ATCTTTCAGGACTGTGGGTTAGG - Intergenic
1013513526 6:110865001-110865023 AGCTTTATGGCATTTGTATTCGG - Intronic
1015740049 6:136444139-136444161 GGCTTTGTGAAATGTTGGTTAGG - Intronic
1018044822 6:159956367-159956389 AGTTTTATCTTATGTGGGTTGGG + Intergenic
1020404059 7:7811745-7811767 AGCTTTATGGCCTGTTGGGTGGG + Intronic
1022435231 7:30377100-30377122 AGCTTTATGAATTGAGGGTTTGG - Intronic
1023966502 7:44965601-44965623 AGCTGAATGGAATGTGTGGTGGG + Intronic
1024407236 7:48995734-48995756 GGCATTATGGTATTTGGGTTTGG - Intergenic
1025611536 7:63078882-63078904 AGGTTTAAGGAATTTGGCTTAGG + Intergenic
1025639922 7:63356599-63356621 AGCTTTGTGGAATTTTGATTGGG + Intergenic
1025642777 7:63391493-63391515 AGCTTTGTGGAATTTTGATTGGG - Intergenic
1025708095 7:63885609-63885631 GGCTTTAAGGAATTTGGCTTAGG - Intergenic
1028102562 7:86839147-86839169 ACCTGTATGGATTGTGGGTCTGG + Exonic
1028209494 7:88055759-88055781 AGCGTTATGAAAGGTGTGTTAGG - Intronic
1029605418 7:101596326-101596348 TGCTTTATGTGATGTTGGTTGGG - Intergenic
1030359199 7:108577822-108577844 AGATTTGTGAAATCTGGGTTGGG + Intergenic
1031335426 7:120524740-120524762 AGCTTCATAGAATGTGCATTAGG - Intronic
1032504599 7:132425757-132425779 AGCCTTCTGGAATTTGGCTTTGG - Intronic
1034778760 7:153857503-153857525 AGCTTTCTGGCATGTGACTTAGG + Intergenic
1035939254 8:3877388-3877410 GCCTGTATGGAACGTGGGTTCGG - Intronic
1036138345 8:6182506-6182528 GGCTGTAAGGAATGTGTGTTTGG - Intergenic
1037006038 8:13781303-13781325 AACTTTATGAAATGGGGCTTTGG - Intergenic
1038963888 8:32549920-32549942 TGCTTCATGAAATGTGTGTTGGG - Intronic
1044056429 8:87575884-87575906 TCCTTTATGGCATGTGGCTTGGG + Intronic
1044375529 8:91465692-91465714 TGCTTTATGAAAGGTGGGTGGGG - Intergenic
1047901205 8:129423825-129423847 AGCCATCTGGAATGGGGGTTAGG - Intergenic
1049137452 8:140916230-140916252 ATTTTTAAGGAATGTGGATTAGG + Intronic
1051871373 9:21741436-21741458 AGCTTTTTGGCATGTCTGTTAGG + Intergenic
1054709802 9:68499962-68499984 AGCTTTAATGAATGTGGGAGTGG - Intronic
1056946770 9:91004495-91004517 AGCCTTATGGAATCTGGCTGTGG - Intergenic
1060202431 9:121659225-121659247 AGATTTGTGGACTTTGGGTTCGG + Intronic
1060433645 9:123573322-123573344 AGCCATCTGGAATTTGGGTTGGG + Intronic
1061213866 9:129208972-129208994 AGTTTTATGGAGTGTGCGTCTGG + Intergenic
1187967181 X:24623658-24623680 AGCCTGATGAAATGTGGCTTTGG - Intronic
1190915132 X:54806015-54806037 TGCTATATGGAGTGTGGATTAGG - Intergenic
1192537346 X:71939366-71939388 AGCAGTATAGAAGGTGGGTTAGG + Intergenic
1192603402 X:72488347-72488369 AGCCTTATGGAATGGGGGTGGGG - Intronic
1193378867 X:80794927-80794949 TGCTTTATTGGTTGTGGGTTTGG - Intronic
1197256565 X:124269721-124269743 GGTTTTATGGAATATGGTTTGGG - Intronic
1198480606 X:137036258-137036280 AGCTTTGGGGAATGTGGATTTGG + Intergenic
1201398801 Y:13580026-13580048 AGCTTTATGCAACGTGGTGTTGG - Intergenic