ID: 912780174

View in Genome Browser
Species Human (GRCh38)
Location 1:112539130-112539152
Sequence CTATATATACATTTAAAGCT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 434
Summary {0: 1, 1: 0, 2: 1, 3: 25, 4: 407}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
912780174_912780180 22 Left 912780174 1:112539130-112539152 CCAAGCTTTAAATGTATATATAG 0: 1
1: 0
2: 1
3: 25
4: 407
Right 912780180 1:112539175-112539197 AATGTAGATTCTGATTCAGAAGG 0: 2
1: 32
2: 243
3: 649
4: 1269
912780174_912780181 27 Left 912780174 1:112539130-112539152 CCAAGCTTTAAATGTATATATAG 0: 1
1: 0
2: 1
3: 25
4: 407
Right 912780181 1:112539180-112539202 AGATTCTGATTCAGAAGGTCTGG 0: 10
1: 149
2: 755
3: 1782
4: 3023

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
912780174 Original CRISPR CTATATATACATTTAAAGCT TGG (reversed) Intronic
903311336 1:22459186-22459208 CTATATAAAGATATAAAACTTGG - Intronic
907207230 1:52783781-52783803 ATATATATATATATAAAGCTGGG - Intronic
907697903 1:56752568-56752590 CCATTTATACATTTAATTCTTGG - Intronic
908001590 1:59685526-59685548 ATATATATACATATAAACATGGG + Intronic
908190994 1:61703711-61703733 ATATATATATATATAAAGATTGG - Intronic
908674552 1:66589206-66589228 ATATATATATATGTAAGGCTTGG + Intronic
908700520 1:66894616-66894638 CTATATATAAAATTAATTCTGGG - Intronic
909070666 1:70990056-70990078 ATATATATACACATACAGCTGGG + Intronic
909894650 1:81052287-81052309 CTAGATTTACATTTAAACCCAGG + Intergenic
910666416 1:89729706-89729728 ATATATATATATTTAAAAATTGG + Intronic
912086608 1:106014049-106014071 CTATATATACTCTGAAATCTAGG + Intergenic
912780174 1:112539130-112539152 CTATATATACATTTAAAGCTTGG - Intronic
913011742 1:114690084-114690106 CTGTATAGACATTAATAGCTGGG - Intronic
913389305 1:118292855-118292877 ATATATATACATCTAATGCCAGG + Intergenic
913557601 1:119983780-119983802 CTACATATACATAAAAGGCTTGG - Intronic
913560815 1:120017572-120017594 CTATAAATACACTTGAAGTTTGG + Intronic
913637312 1:120776030-120776052 CTATAAATACACTTGAAGTTTGG - Intergenic
913708365 1:121451961-121451983 CAATATCTACATTCAATGCTGGG - Intergenic
914281398 1:146176985-146177007 CTATAAATACACTTGAAGTTTGG + Intronic
914542443 1:148627920-148627942 CTATAAATACACTTGAAGTTTGG + Intronic
914624190 1:149443323-149443345 CTATAAATACACTTGAAGTTTGG - Intergenic
915220880 1:154373525-154373547 ATATATATATATTTATGGCTGGG - Intergenic
915272680 1:154766409-154766431 ATATATATATATATAAAGCCTGG - Intronic
916371710 1:164104216-164104238 CCATATATACATATTAAGGTGGG - Intergenic
916799691 1:168204817-168204839 ATATATACACATAAAAAGCTTGG + Intergenic
917324772 1:173821031-173821053 TTCAATATGCATTTAAAGCTAGG - Intronic
919367674 1:196684982-196685004 TTATATAAACATTTAAAAGTGGG - Intronic
920918205 1:210275800-210275822 GTGTAAATACATGTAAAGCTGGG - Intergenic
921658902 1:217775682-217775704 CTATATATATATATATAGATCGG - Intronic
921735754 1:218626209-218626231 CAATATATATATATAAAGCTAGG + Intergenic
921901376 1:220455133-220455155 CTATAAATTCACTTATAGCTTGG + Intergenic
922025586 1:221745226-221745248 TCATATATACCTTTAAAGATAGG - Intergenic
923872068 1:238006298-238006320 TTAGATTTCCATTTAAAGCTTGG - Intergenic
1062772656 10:115303-115325 CTATATATTCTTTTAAACTTTGG + Intergenic
1062849490 10:732569-732591 ATATATGTACATTTAAAACTTGG + Intergenic
1063356850 10:5409022-5409044 ATATATATATATATAAAACTTGG + Intergenic
1063405708 10:5792648-5792670 CTGTATATATTTTTAAGGCTAGG - Intronic
1063438268 10:6051812-6051834 ATATATATATATATATAGCTGGG - Intronic
1063955146 10:11258674-11258696 TTATATATACATTTCCACCTTGG - Intronic
1064322207 10:14316095-14316117 CAATATCTACTTCTAAAGCTGGG - Intronic
1064434717 10:15301339-15301361 ATATATATATATATATAGCTGGG - Intronic
1065560356 10:26958066-26958088 ATATATATATATATAAAACTGGG - Intergenic
1066136078 10:32447334-32447356 TTATATATACATAGAAAGCAAGG - Intronic
1067778996 10:49185149-49185171 CTAGATATATATTTAAAGGTAGG - Intronic
1067910947 10:50346491-50346513 CTATATATTTTTTAAAAGCTTGG - Intronic
1067924631 10:50495532-50495554 TTATATGTACATTTAAATATTGG - Intronic
1070900193 10:80021966-80021988 CTATATATATACTCAAACCTGGG + Intergenic
1072501799 10:96025205-96025227 ATATATATATATATATAGCTGGG + Intronic
1072644293 10:97240354-97240376 TTATATAAACATTTAAGGTTGGG + Intronic
1074593189 10:114834075-114834097 CTATATAGACTTTTAGGGCTGGG - Intronic
1074651024 10:115524711-115524733 CTATTTATACACTTAAAGAGTGG + Intronic
1074866856 10:117549261-117549283 CAATAGATAGATTTAAAGTTTGG - Exonic
1075098452 10:119489472-119489494 CTATATATTTTTTTAATGCTCGG - Intergenic
1075218609 10:120562942-120562964 ATAAATATACATTTCAGGCTGGG + Intronic
1076110030 10:127853034-127853056 ATATATATATATTTTAAGTTGGG - Intergenic
1076588237 10:131564774-131564796 CTATATGGACAATTAAAGCATGG + Intergenic
1078167569 11:8901583-8901605 TAATATAGACATCTAAAGCTTGG + Intronic
1079053222 11:17181593-17181615 ATATATATATATTTAAAAATGGG - Intronic
1080644549 11:34178773-34178795 CTATATATACTCTTAAAAATTGG + Intronic
1080931416 11:36815438-36815460 ATATATATATATTTAAAGTGAGG + Intergenic
1081035740 11:38143722-38143744 CTATATATCCATGTAAAAATCGG - Intergenic
1081139438 11:39480120-39480142 TTCTATATACATTTAAAAGTAGG - Intergenic
1082047512 11:47742126-47742148 CTTTATATACGTTTACAGTTAGG - Intronic
1084498481 11:69519945-69519967 ATATATATATATATATAGCTGGG + Intergenic
1086177947 11:83914852-83914874 CTATATCTACAATTAGATCTTGG - Intronic
1088142905 11:106639216-106639238 ATATTTATACATGTAAAGGTAGG - Intergenic
1088209072 11:107432772-107432794 GGATATAGACATTTAAAGCAAGG - Intronic
1088559139 11:111095435-111095457 GTATTTATACACTTAAAGATTGG - Intergenic
1088660036 11:112036084-112036106 ATATATATATGTTTAAGGCTGGG - Intronic
1088705025 11:112454262-112454284 CTATATATATATTTTGAGATAGG - Intergenic
1088981586 11:114869403-114869425 TTATATATACATTTAGAGACAGG + Intergenic
1090125784 11:124082221-124082243 CTATATTTACTTTAAAAGCATGG + Intergenic
1092870761 12:12803822-12803844 TTGTGTATACATTTAAGGCTGGG + Intronic
1093230554 12:16537592-16537614 CCATACATACATTGAAATCTAGG + Intronic
1093606993 12:21104129-21104151 ATATATACACATGTAAAGTTTGG + Intronic
1093612525 12:21179830-21179852 CTGTATCTACATATAAAGATGGG - Intronic
1094733289 12:33202623-33202645 ATATATAAACATGTGAAGCTTGG - Intergenic
1095144199 12:38704852-38704874 ATATATATATATTTAAATTTCGG + Intronic
1095920789 12:47527812-47527834 GTATATATATATTTAGAGATAGG + Intergenic
1096759417 12:53827805-53827827 CCATATATACATATAAAACATGG - Intergenic
1097446257 12:59675912-59675934 CTATATATATATATATATCTGGG - Intronic
1097511132 12:60541685-60541707 CTATATATGTACTTACAGCTAGG + Intergenic
1097764110 12:63503979-63504001 CTAAATATAAAATTCAAGCTTGG + Intergenic
1098261000 12:68670661-68670683 GTATATATAAATTTAAAATTTGG + Exonic
1099103759 12:78476115-78476137 CAACATATATATTGAAAGCTAGG - Intergenic
1099421789 12:82470889-82470911 CTACATGAACAGTTAAAGCTGGG + Intronic
1099689268 12:85930185-85930207 TTAGATATACATTTAAAAATTGG - Intergenic
1100764410 12:97847667-97847689 TTATACATAATTTTAAAGCTAGG + Intergenic
1101509305 12:105378756-105378778 ATATATATATATATAAAGCCTGG + Intronic
1101907955 12:108841846-108841868 ATATATATATATATATAGCTAGG + Intronic
1102652742 12:114454241-114454263 ATATTTCTACATTTGAAGCTGGG + Intergenic
1103148064 12:118612445-118612467 TTATATATATATATATAGCTGGG + Intergenic
1103372346 12:120429247-120429269 ATATATATATGTATAAAGCTGGG + Intergenic
1104250817 12:127091924-127091946 ATATATATATATGAAAAGCTTGG + Intergenic
1106122444 13:26871849-26871871 TTAAATATACATCTCAAGCTGGG + Intergenic
1106292020 13:28372586-28372608 ATATATATATATATATAGCTGGG + Intronic
1106916695 13:34523323-34523345 CTATTTTGACATTTAAAGATGGG + Intergenic
1107284146 13:38770926-38770948 GTATAGAAACATCTAAAGCTAGG + Intronic
1108010540 13:46003764-46003786 CTGTCTATTCATTTAAAACTGGG + Intronic
1108846489 13:54684375-54684397 CTATATATACTTATAAATTTAGG + Intergenic
1109127817 13:58540288-58540310 TTTTATGTCCATTTAAAGCTAGG - Intergenic
1109660495 13:65452554-65452576 CTATATATATATATATATCTTGG - Intergenic
1110360753 13:74622222-74622244 GTATAAATACATTAGAAGCTAGG + Intergenic
1110462543 13:75761065-75761087 ATATATATATATTTAAACTTAGG + Intronic
1110508336 13:76316435-76316457 GTGTATATATATTTAAAACTAGG + Intergenic
1110856775 13:80305107-80305129 CTATATATCTGTTTAAATCTTGG + Intergenic
1111259331 13:85715407-85715429 CTATCTATATTTTTAAAGCTGGG + Intergenic
1111724380 13:91986497-91986519 CTATATGAAAATGTAAAGCTGGG - Intronic
1112099701 13:96174572-96174594 ATAGGTATACATTTAAAGTTAGG - Intronic
1112558127 13:100488022-100488044 ATATATATACATATATGGCTGGG - Intronic
1113197975 13:107831606-107831628 GTATGTTTACATTTCAAGCTTGG - Intronic
1113319331 13:109217501-109217523 ATATATATATATATTAAGCTGGG + Intergenic
1114511234 14:23263068-23263090 CTATGTAGAAGTTTAAAGCTAGG + Intronic
1115912896 14:38276273-38276295 CTATAAGTACCTTTAAAGCAAGG - Intergenic
1116059896 14:39909654-39909676 CTATATAAATATTAAAATCTTGG + Intergenic
1116193619 14:41692047-41692069 ACATATATACATCTAAAGATTGG - Intronic
1116659084 14:47684531-47684553 CAACATATATCTTTAAAGCTGGG - Intergenic
1116989695 14:51262305-51262327 ATATATATATATATAAGGCTAGG - Intergenic
1118044463 14:61951793-61951815 GTATATATATATTTTAAGATAGG + Intergenic
1118297391 14:64583050-64583072 ATATATATATATATATAGCTGGG - Intronic
1120214935 14:81671588-81671610 CAATATATAGATTTAAAGAATGG - Intergenic
1120291552 14:82579323-82579345 CTATATTTACTTTTTAAACTAGG + Intergenic
1120489412 14:85157589-85157611 CTATATCTACATTTAACAGTTGG - Intergenic
1120816292 14:88862586-88862608 ATATATATATATTTAGAGATGGG + Intronic
1120825011 14:88946817-88946839 ATATATATACATTTGTACCTAGG - Intergenic
1126469570 15:48993687-48993709 ATATATATATATATATAGCTTGG + Intronic
1127548802 15:60016655-60016677 CTATATACATCTTTAAAGATGGG - Intronic
1129135220 15:73543280-73543302 CTTTTTAAACATTTAAAACTAGG + Intronic
1129781310 15:78273715-78273737 TTATATATACATTTAAGTCAGGG - Intronic
1130902240 15:88215774-88215796 CTATATATACTTTTAAAATATGG + Intronic
1131180891 15:90239106-90239128 CTATATAAACAGTTGAAGATTGG + Intronic
1133192537 16:4145038-4145060 ATATATATATATTTAGAGATGGG - Intergenic
1133750798 16:8723800-8723822 ATATATATATATAAAAAGCTTGG - Intronic
1133764486 16:8827963-8827985 TTATATATATATATAAAACTTGG + Intronic
1133909802 16:10055185-10055207 CTATATGTACATGCAAACCTAGG - Intronic
1134351865 16:13444977-13444999 ATATATATATATATATAGCTAGG - Intergenic
1136601769 16:31297172-31297194 ATATATATACACTTAGAGATTGG + Intronic
1137544584 16:49392414-49392436 CTAGATACACATTTAAAACCAGG + Intronic
1138763230 16:59568758-59568780 CTTTTTAAACATTTTAAGCTAGG + Intergenic
1138920329 16:61520405-61520427 CTATATATAGATATATAGATAGG + Intergenic
1139030063 16:62869119-62869141 CTATATATACAATTAAACAGAGG - Intergenic
1139326803 16:66158868-66158890 GTATATATATATATAAAGATAGG - Intergenic
1139361362 16:66402171-66402193 CTATATACATAAGTAAAGCTGGG - Intronic
1139780579 16:69348277-69348299 CCTTGTATACAATTAAAGCTAGG + Intronic
1140413694 16:74758011-74758033 GTATATATATATTTAAAGACAGG - Intronic
1140470214 16:75209527-75209549 CTTTATATACATTTTAAGTGAGG - Intergenic
1143603389 17:7964779-7964801 ATATATATATATATAATGCTGGG - Intergenic
1144222403 17:13112062-13112084 ATATATATATATATATAGCTGGG - Intergenic
1144231409 17:13208158-13208180 GTATATATACATATAAAACCAGG - Intergenic
1144234328 17:13242639-13242661 GTATATATATTTTTAAATCTAGG + Intergenic
1144365044 17:14535459-14535481 ATATATATATATATATAGCTGGG - Intergenic
1146135725 17:30319262-30319284 ATATATATATATATATAGCTGGG + Intronic
1147112262 17:38272013-38272035 ATATATATATATATATAGCTGGG - Intergenic
1147642576 17:42013100-42013122 CTATAAAAACATTTAAGGCTGGG - Intronic
1148900439 17:50871889-50871911 CTTTAAATACATTTAAAGCATGG + Intergenic
1149171163 17:53813017-53813039 GTAGATATAAATTTAAAACTAGG - Intergenic
1149617084 17:58009734-58009756 CTATATATATACTTAAAGGATGG - Intergenic
1149669682 17:58395328-58395350 TTGTATATACATTTAAAGCTAGG - Intronic
1149809126 17:59650367-59650389 CTAAATTAAAATTTAAAGCTAGG + Intronic
1150763303 17:67982013-67982035 ATATATATATATTTAAATATTGG + Intronic
1150813696 17:68376595-68376617 ATATATATATTTTAAAAGCTAGG - Intronic
1150988182 17:70223543-70223565 TTATGTATACTTTTTAAGCTGGG + Intergenic
1153082386 18:1242871-1242893 ATATTTAGACTTTTAAAGCTGGG - Intergenic
1153305558 18:3627664-3627686 CTATATATATTTTTAGAGATGGG + Intronic
1155267924 18:24111894-24111916 ATATATATATTTTTAAAGATAGG - Intronic
1155382339 18:25237904-25237926 ATATATATACATGAAAAGTTAGG - Intronic
1155773332 18:29727215-29727237 CTATATATCCTTTGAAATCTAGG - Intergenic
1157457838 18:47853000-47853022 CTTGGTATACATTTGAAGCTTGG - Intronic
1157524230 18:48367168-48367190 ATATATATATATATAAAACTTGG - Intronic
1158456360 18:57611766-57611788 ATATATATAATTTTAAAGATAGG + Intronic
1159158701 18:64616600-64616622 TTATATAACCATTTAGAGCTTGG - Intergenic
1159721179 18:71893122-71893144 ATATATATAAATATAAAGATGGG - Intergenic
1161740733 19:6019594-6019616 ATATATATATATTTAGAGATAGG + Intronic
1162606579 19:11713272-11713294 CAATATATATATTTTAAGCCTGG - Intergenic
1162814057 19:13182501-13182523 ATATATATATATGTAAAGATGGG - Intergenic
1165853332 19:38864287-38864309 ATATATATATATATAAAACTTGG - Intergenic
1167931101 19:52865427-52865449 ATATATATATATATAAAGCCTGG - Intronic
1168223019 19:54974744-54974766 CTATAAATACATACAAAGCGGGG + Intronic
925485796 2:4329172-4329194 CCATATATTCATTTAAGTCTAGG - Intergenic
925763883 2:7212274-7212296 ATATATATATCTCTAAAGCTGGG + Intergenic
927169562 2:20357565-20357587 ATATATATAAATATAAAGCCAGG + Intergenic
927741863 2:25577628-25577650 CTATTTATACTTTTAAATGTTGG + Intronic
928212334 2:29332609-29332631 CTATACATACTTATAAAGCATGG - Intronic
928483935 2:31710863-31710885 CTTGATATAAATTTAAAACTAGG - Intergenic
928889168 2:36182075-36182097 CTATATATATATCTATATCTAGG - Intergenic
928971905 2:37038446-37038468 CCTTATTTACATTTAAAGATAGG - Intronic
929366766 2:41167767-41167789 CTATTTAGACATCTAAAGCCAGG + Intergenic
930544699 2:52751555-52751577 ATATATATACATATAAAACATGG - Intergenic
930788975 2:55303685-55303707 GAACATATACTTTTAAAGCTTGG + Intronic
930813804 2:55570999-55571021 CAATATAAACATTTAAATATTGG + Intronic
931938875 2:67230297-67230319 CAATGTATACATTTAATGCTTGG + Intergenic
931951384 2:67366751-67366773 CTATTTAAACATTTAAAGTTAGG - Intergenic
933933883 2:87184008-87184030 CTATTTATACATTTCAATCCTGG - Intergenic
935981891 2:108635800-108635822 CTGTATTTACATTCAAAACTAGG - Intronic
936350979 2:111712371-111712393 CAATATGTACATTTAACACTGGG - Intergenic
936359224 2:111781437-111781459 CTATTTATACATTTCAATCCTGG + Intronic
936384736 2:112019170-112019192 CTGTAAATACTTTTAAAGATGGG + Intronic
939768437 2:146283565-146283587 ATGTATATATATTTAGAGCTGGG - Intergenic
940345854 2:152627593-152627615 ATATATAAAGATTTAAAGCCAGG - Intronic
941200550 2:162503235-162503257 CTATATATTCATATAATGGTAGG + Intronic
942851096 2:180487122-180487144 TTATATATACATTTTAAATTAGG + Intergenic
943124311 2:183777432-183777454 GTATATATGCATGTAAAGATAGG - Intergenic
943453974 2:188079676-188079698 GTATATATATATTTAATGATTGG - Intergenic
943693413 2:190893878-190893900 CTAAAAATGCATTTGAAGCTGGG - Intronic
944468517 2:200028252-200028274 ATACATATAGCTTTAAAGCTAGG - Intergenic
945580191 2:211584727-211584749 ATATACATATATTTAAAGTTAGG - Intronic
946892675 2:224294461-224294483 CTATAAATAGTTTTAAATCTGGG - Intergenic
947164692 2:227250016-227250038 CAAAATATAGATTTAAGGCTGGG + Intronic
947495118 2:230629826-230629848 ATATATATATATATAAAGTTTGG - Intergenic
1169711726 20:8571808-8571830 CTTTATGGACATTTAAAGCTCGG + Intronic
1170945404 20:20887011-20887033 ATATATATGTATGTAAAGCTGGG - Intergenic
1172512610 20:35511051-35511073 CAAAATGTACATTTAAAACTGGG + Intronic
1176914922 21:14613791-14613813 TTATATATATATTTAAAAGTTGG - Intronic
1177690306 21:24497975-24497997 ATATATATACAATTAAAGGCAGG + Intergenic
1178133075 21:29595244-29595266 CTTTATATAATTTCAAAGCTTGG + Intronic
1178231392 21:30788846-30788868 CTATCTAGAGATCTAAAGCTAGG + Intergenic
1178408367 21:32344481-32344503 CTATAGATGCATTTCAAGCCAGG - Intronic
1178422654 21:32454629-32454651 ATATGAATACATTTAAAGCAGGG + Intronic
1178463538 21:32825579-32825601 CTATATATAGATGTAAAGAAAGG + Intergenic
1178862674 21:36302351-36302373 CAATATGTACATATGAAGCTAGG + Intergenic
1180571567 22:16727049-16727071 TTATACATACATTTAGAGTTAGG - Intergenic
1182164808 22:28162532-28162554 CTTTCTATACATTAAAAGGTTGG + Intronic
1182805316 22:33064786-33064808 ATAGATACACATTTCAAGCTGGG - Intergenic
949828587 3:8188919-8188941 CTATATTTAAAATTAAAGTTGGG + Intergenic
950827062 3:15834750-15834772 CTATTTATACATTTATAGAAAGG + Intronic
953318767 3:41953574-41953596 ATATATATATTTTTTAAGCTAGG + Intronic
953430701 3:42837391-42837413 ATATATATATATTTAGAGATGGG + Intronic
954348394 3:50021342-50021364 CATTAAATACATTTAAGGCTGGG + Intronic
954547540 3:51451255-51451277 ATATATATATATTTACAGATGGG + Intronic
955527182 3:59833188-59833210 CAACATATCCATTTGAAGCTGGG - Intronic
955817279 3:62858501-62858523 CTGTATCTACTTCTAAAGCTGGG + Intronic
956047908 3:65215931-65215953 ATATATATACATACACAGCTAGG - Intergenic
956941951 3:74173020-74173042 CTAAATATAGTTTTAAACCTTGG - Intergenic
957106625 3:75897418-75897440 TTATACATACATTTAGAGTTAGG + Intergenic
957160653 3:76605346-76605368 CTATAAAAACATGTAAACCTGGG - Intronic
957591302 3:82202094-82202116 CTAAATATGCATTTAGAACTAGG + Intergenic
957670813 3:83300305-83300327 CTAGATATACATATAAACATTGG - Intergenic
958953529 3:100441964-100441986 CTATATAAAAATATAAAGCTAGG - Intronic
959028353 3:101268621-101268643 ATATATATATATATAAAGCCTGG + Intronic
959329711 3:104988218-104988240 ATATATATACTTTTAGAGATGGG + Intergenic
959536774 3:107495612-107495634 CTATATAAAAATATAAAACTTGG - Intergenic
960732386 3:120741684-120741706 ATATATATATATTTAACACTAGG + Intronic
961075068 3:123974747-123974769 ATGTATAGATATTTAAAGCTTGG - Intronic
961308626 3:125977775-125977797 ATGTATAGATATTTAAAGCTTGG + Intronic
962392280 3:134983055-134983077 CTATATATCGATATAAGGCTTGG + Intronic
963229368 3:142894137-142894159 CAATATATAAATAAAAAGCTGGG + Intergenic
963446551 3:145417108-145417130 CTATTTTTACAATTAAAGTTAGG - Intergenic
963760938 3:149286857-149286879 ATATATATATATATAAACCTTGG + Intergenic
964099092 3:152967025-152967047 CTATATTAACATTTTAAGTTAGG + Intergenic
964713935 3:159701639-159701661 TTATATATACTTTTAAATATTGG + Intronic
964784589 3:160381229-160381251 ATATATATATATTTAGAGATGGG - Intronic
965647119 3:170895844-170895866 ATATATATATTTTTAAAGATGGG + Intronic
966092127 3:176152353-176152375 ATATATATACAGTAAATGCTTGG + Intergenic
966479112 3:180385352-180385374 CTATACCTACATTTAAACCTAGG - Intergenic
966481780 3:180417585-180417607 CTATATACACATTCAAATTTTGG + Intergenic
966610506 3:181863267-181863289 ATATATATATATTTAAAAGTTGG - Intergenic
967432901 3:189408169-189408191 ATATATACAAATTTAAAACTTGG + Intergenic
967451719 3:189631427-189631449 GTATATATAGATATAAAGCCGGG - Exonic
968312277 3:197694060-197694082 ACATATATATATTTAGAGCTGGG + Intronic
970105498 4:12578007-12578029 CTATATATACATTTCCTTCTTGG + Intergenic
971357673 4:25909638-25909660 CTATATATACTTATACAGATGGG + Intronic
971837391 4:31786161-31786183 CTGTAAATACAGATAAAGCTTGG - Intergenic
972478484 4:39475566-39475588 CTATAAAGACATTTAAGGCCGGG + Intronic
972516946 4:39817875-39817897 ATATATATATATATATAGCTGGG - Intergenic
973912502 4:55595535-55595557 ATATATATATATATACAGCTGGG - Intronic
974169969 4:58253946-58253968 GTATTTGTACATTTAAAACTGGG + Intergenic
974471542 4:62325213-62325235 ATATATATATATTTAGAGATGGG + Intergenic
975016219 4:69424294-69424316 CTATATATACATATATACCATGG - Intergenic
975539325 4:75489135-75489157 TTATATATACATGTAAAATTTGG - Intronic
975856575 4:78631065-78631087 CTATATATAGATATATAGATAGG - Intergenic
976495345 4:85722872-85722894 CTATATTTATATTAAATGCTGGG + Intronic
976528121 4:86117111-86117133 CTTTAAATACATTATAAGCTGGG + Intronic
976567755 4:86571254-86571276 ATATATATATATTTAAATTTTGG - Intronic
977033083 4:91912519-91912541 CTTTATATACATATAACCCTTGG + Intergenic
977697173 4:99979451-99979473 ATATATATACATGCAAAGCATGG + Intergenic
977910147 4:102524891-102524913 CTGTATATACAGATGAAGCTTGG + Intronic
978418032 4:108499377-108499399 ATATATATATATATATAGCTGGG - Intergenic
979908367 4:126327360-126327382 ATTTATATACATTTACAGATGGG - Intergenic
979966429 4:127081697-127081719 ATATAAATACTTCTAAAGCTTGG - Intergenic
980062580 4:128148133-128148155 CTTAATATGCATCTAAAGCTGGG + Intronic
980179411 4:129385946-129385968 CTATATATACATATACAAATAGG + Intergenic
981722337 4:147814305-147814327 CTTCAAATAAATTTAAAGCTTGG - Intronic
981980094 4:150781474-150781496 CTATAAATACAGATGAAGCTTGG + Intronic
982945969 4:161622911-161622933 CAATCTATAAATATAAAGCTGGG + Intronic
983126487 4:163958881-163958903 CTATAAATCCTTTTAAAGCCTGG - Intronic
983136594 4:164091403-164091425 ATATATATATATATAAAACTTGG - Intronic
983654839 4:170072305-170072327 ATATATATATATTTAGAGTTGGG + Intronic
983899730 4:173121035-173121057 CTATGTAGACATTTAAATTTTGG + Intergenic
983943378 4:173559720-173559742 CTATCTAAACATTTAAAAGTGGG - Intergenic
986390474 5:7281278-7281300 TTATATATAAATATAAAGATGGG - Intergenic
986960701 5:13207640-13207662 CTATATATATATTAAATGCAAGG + Intergenic
987091979 5:14516355-14516377 ATATATATATATTTAGAGATGGG - Intronic
987855694 5:23417257-23417279 GTATATATATATTTAAAGCACGG + Intergenic
987867879 5:23569946-23569968 TTATATAGATATTTAAAACTTGG + Intergenic
988109606 5:26801154-26801176 CTATATATATATATATATCTGGG - Intergenic
988146780 5:27319386-27319408 TTAGATATTCATTTAAATCTTGG - Intergenic
988288593 5:29255138-29255160 TTATCTATACATTTAAAGACAGG - Intergenic
988387415 5:30583193-30583215 ATATATATATATATAAAGGTAGG - Intergenic
989431808 5:41364233-41364255 CAATATAGACATTTTAAGCAAGG - Intronic
989741007 5:44771960-44771982 CTATATAGCCATTTAAGACTAGG + Intergenic
989969732 5:50508597-50508619 CAATATCTACATTCAATGCTGGG + Intergenic
990033521 5:51291484-51291506 CTATATGCACATTTAAAACAAGG + Intergenic
991623925 5:68577836-68577858 ATATATATACTTTTAAAGTATGG - Intergenic
992165406 5:74045384-74045406 CTATATATATATTTTAAGTTAGG + Intergenic
992600412 5:78393180-78393202 ATATATATATATTTAGAGATAGG + Intronic
993204229 5:84860306-84860328 CTATTTAAACATCTAAAGCAAGG + Intergenic
993325634 5:86532112-86532134 CTATAAATCCATTTAAAAATAGG - Intergenic
993818665 5:92585565-92585587 CTATATATCCATGTAAGGCCAGG - Intergenic
994346336 5:98691726-98691748 CTATATATATATATAAACCCTGG - Intergenic
994585214 5:101699091-101699113 ATATATATATGTATAAAGCTTGG - Intergenic
994757203 5:103809130-103809152 CTATGTATATATTCAAAGTTAGG + Intergenic
994981378 5:106878381-106878403 TTATATAAACATTTAAATATAGG - Intergenic
995077898 5:108009219-108009241 ATATATATATATATACAGCTTGG + Intronic
995102683 5:108333197-108333219 CTATAAATATATTTTATGCTTGG - Intronic
996129745 5:119768170-119768192 CTATATATGAACTTATAGCTAGG - Intergenic
996448763 5:123592740-123592762 CTATATATATATATATAGCATGG + Intronic
998719612 5:144929332-144929354 CTATAGTTACTTTTAATGCTAGG - Intergenic
999162311 5:149512317-149512339 ATATATATATATTTAAGGATAGG + Intronic
1000200124 5:159001014-159001036 CTATATATATTTATGAAGCTGGG + Intronic
1000471362 5:161646065-161646087 ATATATATATATATATAGCTGGG + Intronic
1001365285 5:171132069-171132091 ATAAATATACATTTACTGCTTGG - Intronic
1002800534 6:517907-517929 CGATTTATTCATTTAAAGATGGG + Intronic
1003106868 6:3223898-3223920 CTACATATCCATTTAAAGGAGGG + Intergenic
1004263736 6:14131180-14131202 CTATGTATACATGTATAGATAGG - Intronic
1005044834 6:21631960-21631982 ATACATATACACTTAAGGCTGGG + Intergenic
1006114293 6:31767100-31767122 TTATATATATATATAAAACTGGG + Intronic
1007647201 6:43392090-43392112 TTACATATAGAATTAAAGCTTGG - Intergenic
1009354559 6:62726481-62726503 CTATATATGTATTTACAGGTAGG + Intergenic
1009459343 6:63893766-63893788 CTGAAGATAAATTTAAAGCTTGG - Intronic
1009809036 6:68637149-68637171 CTATATAGAGATTTAGAGTTGGG + Intronic
1009912978 6:69956383-69956405 CTATATATATATTTTTAACTTGG + Intronic
1010668467 6:78657181-78657203 GTATAAATACATCTAAAACTGGG + Intergenic
1010801388 6:80179680-80179702 ATATATATATATTCAAACCTTGG - Intronic
1010858049 6:80868218-80868240 CCATATTTAAATTTAAGGCTAGG - Intergenic
1011407323 6:87029813-87029835 TTAAATATACATTTACATCTTGG + Intergenic
1011508215 6:88071664-88071686 ATATATATATATTTAAAGCCAGG - Intergenic
1011911383 6:92444598-92444620 ATATATATATATATAAAACTGGG - Intergenic
1012125272 6:95420730-95420752 CTATATATCCTCTGAAAGCTAGG + Intergenic
1012346128 6:98189098-98189120 CTATAAACATATTTAAAGCATGG - Intergenic
1012373719 6:98536593-98536615 ATATATATACCTTTAATTCTTGG - Intergenic
1012443702 6:99287264-99287286 ATATATATATTTTTTAAGCTGGG - Intronic
1012948331 6:105491321-105491343 CTAAATATACATTCTAAGGTGGG + Intergenic
1013071614 6:106734479-106734501 ATATATATGCATTTAAAAATTGG - Intergenic
1013222331 6:108089956-108089978 TTATGTATACATATAAATCTTGG + Intronic
1014115882 6:117668655-117668677 GTATATTTACATTTAAAGTGGGG - Intergenic
1014874328 6:126638150-126638172 AAATATATACATTCAAAGCCTGG - Intergenic
1015201800 6:130591180-130591202 ATATATATATATTTAAAGTCAGG + Intergenic
1016633746 6:146262823-146262845 ATATGTATACATTTAAATTTGGG - Intronic
1017314058 6:153008592-153008614 TTATAGATACATCTAAAGTTAGG + Exonic
1017659140 6:156656767-156656789 CTATATATATATTTTGAGATAGG - Intergenic
1017679729 6:156851362-156851384 CTAAATATACAATTAAACATTGG - Intronic
1018804348 6:167247494-167247516 ATATATATATATTTTAACCTTGG + Intergenic
1019675434 7:2309218-2309240 CTATTTATACATTTTGAGCAGGG - Intronic
1020201505 7:6083549-6083571 ATATATATGTATTTAAGGCTAGG - Intergenic
1022863350 7:34390981-34391003 ATATATATATATATATAGCTTGG - Intergenic
1023285009 7:38609708-38609730 GTATATATACATTTAAATAGTGG + Intronic
1023307929 7:38850440-38850462 ATATATATACTCTTAAAACTTGG + Intronic
1024714413 7:52058975-52058997 ATATATATATATTTAAATTTGGG + Intergenic
1025264563 7:57444852-57444874 CTATATATATATTTATATATAGG - Intergenic
1025264575 7:57445098-57445120 CTATATATACATTTATATATAGG + Intergenic
1025264579 7:57445307-57445329 CTATATATATATTTATATATAGG - Intergenic
1027300088 7:76824320-76824342 ATATGTATACATTTAAAGAAAGG + Intergenic
1028150857 7:87369805-87369827 TTATATATATTTTTTAAGCTAGG - Intronic
1028592615 7:92513991-92514013 ATATAAATATATTCAAAGCTTGG + Intronic
1028814483 7:95129020-95129042 TTTTATATACAGTGAAAGCTAGG + Intronic
1031332184 7:120479755-120479777 ATATATATATATTTAGAGATGGG - Intronic
1032462870 7:132124966-132124988 TTCTATATACTTTTAAAACTTGG + Exonic
1032662960 7:134005909-134005931 CTCCATATACATTTAAGGATTGG - Intronic
1033132474 7:138756636-138756658 CAATTCATACATTTAAAACTGGG + Intronic
1033456011 7:141504236-141504258 ATATATGTACTTTAAAAGCTTGG - Intergenic
1033797157 7:144859368-144859390 ATATATATAAATTTAAAGCCAGG - Intergenic
1033926856 7:146472630-146472652 ATCTATATTGATTTAAAGCTTGG - Intronic
1034015167 7:147575298-147575320 ATATATATACCCCTAAAGCTAGG - Intronic
1034050159 7:147975165-147975187 CTAAATAAATATTTAAAGTTGGG + Intronic
1034637918 7:152581939-152581961 ATATATATATATATAAAGCTGGG + Intergenic
1035593778 8:838020-838042 ATATATATAAATTTCAGGCTGGG - Intergenic
1036405718 8:8453546-8453568 ATATATATATATTTAAAAATAGG - Intergenic
1036483418 8:9157873-9157895 CTTTATATACATATAATGCAAGG + Intronic
1037072515 8:14669195-14669217 ATATATATATATATATAGCTGGG + Intronic
1037151825 8:15645213-15645235 CTATTTACACAATAAAAGCTGGG + Intronic
1037470268 8:19201748-19201770 CTATAAAAACACCTAAAGCTGGG - Intergenic
1038321250 8:26529333-26529355 CTATATATATATTTAGAGACAGG + Intronic
1040062748 8:43118241-43118263 CCATATATACATGTAGATCTAGG - Intronic
1041922755 8:63201229-63201251 TTATATAGAGATTTACAGCTAGG + Intronic
1042035044 8:64523687-64523709 TAATATATATTTTTAAAGCTTGG + Intergenic
1042576906 8:70230862-70230884 GTATATATAATTTTATAGCTGGG + Intronic
1042892145 8:73624413-73624435 CTATATATCCATTTAGAGAAGGG - Intronic
1043558387 8:81461110-81461132 CTGTCTATAAATTTGAAGCTGGG + Intronic
1043711407 8:83423318-83423340 CTATATCTCCATTTAAATATAGG - Intergenic
1043753173 8:83967323-83967345 CTATATATACAATTTTACCTAGG - Intergenic
1044130972 8:88524678-88524700 CTAGACATACATTAAAAACTTGG + Intergenic
1044328124 8:90884112-90884134 ATATATATACATTTTAATTTTGG - Intronic
1045352387 8:101353762-101353784 ACATATATACATTTAGTGCTGGG - Intergenic
1045538659 8:103059934-103059956 ATATATATACATATATGGCTGGG - Intronic
1045580073 8:103468662-103468684 CTATAAAAATATTTCAAGCTGGG - Intergenic
1045905748 8:107342839-107342861 ATATATATATATTTAAAGATAGG + Intronic
1047029212 8:120858436-120858458 ATATATATATATATATAGCTGGG + Intergenic
1047730755 8:127726117-127726139 CTCTATATACGATTAAAACTGGG + Intergenic
1050716850 9:8538598-8538620 GTACATATATATTTAAAACTAGG - Intronic
1051397237 9:16636916-16636938 ATATATATATATTTAAATCATGG - Intronic
1051901471 9:22047231-22047253 CTATACATAGTTTTAAGGCTTGG - Intergenic
1051975922 9:22948727-22948749 CTATAAATATATTTTGAGCTAGG + Intergenic
1052484382 9:29077840-29077862 CTAGATATAAATATAAAGCCTGG + Intergenic
1055093657 9:72388269-72388291 ATATATATATATATATAGCTGGG + Intergenic
1055923404 9:81485745-81485767 AAATATATACACTTACAGCTAGG + Intergenic
1056374915 9:85998207-85998229 CTATATACACACTTAAGGCCGGG - Intronic
1056440955 9:86620690-86620712 ATATATATATTTTTTAAGCTGGG - Intergenic
1056508168 9:87277175-87277197 TTTTATAGACATTTCAAGCTGGG - Intergenic
1059084978 9:111290932-111290954 CTATATATATATTTAAGGCCGGG - Intergenic
1059717867 9:116930491-116930513 CTCTATATACTTTTTAAGCAGGG + Intronic
1060025201 9:120164889-120164911 CTTTATATGGATTTAAAGCCGGG + Intergenic
1060435897 9:123592798-123592820 CTAAATGTACAGTTAAAGCTGGG - Intronic
1185740599 X:2529020-2529042 CTGTAAATGCATTTAAAACTTGG - Intergenic
1185977652 X:4739534-4739556 CTAAAGATACATTTTAGGCTGGG - Intergenic
1186203530 X:7177804-7177826 ATATATATATATTTAAGGCTGGG - Intergenic
1186633173 X:11373125-11373147 ATATATATACTTTTAAAATTAGG + Intronic
1186848946 X:13560883-13560905 CTATATCTACATGTATAGGTTGG - Intergenic
1188026113 X:25210902-25210924 TTATATATATATAAAAAGCTGGG - Intergenic
1189272761 X:39762852-39762874 CTATATATATATATATAGCCAGG - Intergenic
1189950812 X:46228849-46228871 ATATATATATATATATAGCTGGG + Intergenic
1190060442 X:47207906-47207928 ATACATATATATTTAAAGCTTGG - Intronic
1192565806 X:72162526-72162548 ATATATATATATATATAGCTGGG + Intergenic
1194414411 X:93592775-93592797 TTGTATATAGATTTTAAGCTTGG - Intergenic
1194738949 X:97549266-97549288 CTAAATATACATGTAAATTTGGG + Intronic
1194749004 X:97663512-97663534 CTGTGTATACATGTAAAGCCTGG - Intergenic
1195009432 X:100720880-100720902 CCATATGTACATTAAAAGGTAGG + Intronic
1196396662 X:115270669-115270691 ATAAATATACATTTAAAAATAGG - Intergenic
1197335945 X:125209296-125209318 CTATCTATAAATTTAAATTTAGG - Intergenic
1197722922 X:129756991-129757013 ATATATATATATATATAGCTGGG - Intronic
1198080884 X:133238302-133238324 CTACATATAAATGTAATGCTGGG - Intergenic
1199547686 X:149024060-149024082 GTATATATATATTTAAAAATGGG - Intergenic
1199800269 X:151243806-151243828 ATATATATACATATGAAGCTAGG - Intergenic
1200244989 X:154518266-154518288 GTATACATACACTTAAAGCTGGG + Intergenic
1200370200 X:155716996-155717018 ATATATATATATATATAGCTGGG + Intergenic