ID: 912781841 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 1:112557390-112557412 |
| Sequence | TACCCATGCATGCTACAAAC TGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | Yes |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | No data | |||
| Summary | No data |
Found 2 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 912781841_912781844 | 28 | Left | 912781841 | 1:112557390-112557412 | CCAGTTTGTAGCATGCATGGGTA | No data | ||
| Right | 912781844 | 1:112557441-112557463 | ATAATACTGCATTGTACATATGG | 0: 1 1: 0 2: 4 3: 67 4: 516 |
||||
| 912781841_912781842 | 1 | Left | 912781841 | 1:112557390-112557412 | CCAGTTTGTAGCATGCATGGGTA | No data | ||
| Right | 912781842 | 1:112557414-112557436 | TTGTGCCTCATTTCTTCTTATGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 912781841 | Original CRISPR | TACCCATGCATGCTACAAAC TGG (reversed) | Intronic | ||
| No off target data available for this crispr | |||||