ID: 912781841

View in Genome Browser
Species Human (GRCh38)
Location 1:112557390-112557412
Sequence TACCCATGCATGCTACAAAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
912781841_912781844 28 Left 912781841 1:112557390-112557412 CCAGTTTGTAGCATGCATGGGTA No data
Right 912781844 1:112557441-112557463 ATAATACTGCATTGTACATATGG 0: 1
1: 0
2: 4
3: 67
4: 516
912781841_912781842 1 Left 912781841 1:112557390-112557412 CCAGTTTGTAGCATGCATGGGTA No data
Right 912781842 1:112557414-112557436 TTGTGCCTCATTTCTTCTTATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
912781841 Original CRISPR TACCCATGCATGCTACAAAC TGG (reversed) Intronic
No off target data available for this crispr