ID: 912791499

View in Genome Browser
Species Human (GRCh38)
Location 1:112656477-112656499
Sequence CTTGTCCAGTCCACCATAAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
912791499_912791505 14 Left 912791499 1:112656477-112656499 CCCATTATGGTGGACTGGACAAG No data
Right 912791505 1:112656514-112656536 TGGGAAGCCAGTATTGCAAAGGG No data
912791499_912791501 -6 Left 912791499 1:112656477-112656499 CCCATTATGGTGGACTGGACAAG No data
Right 912791501 1:112656494-112656516 GACAAGTATAGAATTCCTGTTGG 0: 1
1: 0
2: 0
3: 6
4: 123
912791499_912791502 -5 Left 912791499 1:112656477-112656499 CCCATTATGGTGGACTGGACAAG No data
Right 912791502 1:112656495-112656517 ACAAGTATAGAATTCCTGTTGGG No data
912791499_912791504 13 Left 912791499 1:112656477-112656499 CCCATTATGGTGGACTGGACAAG No data
Right 912791504 1:112656513-112656535 TTGGGAAGCCAGTATTGCAAAGG 0: 1
1: 0
2: 1
3: 18
4: 151
912791499_912791506 15 Left 912791499 1:112656477-112656499 CCCATTATGGTGGACTGGACAAG No data
Right 912791506 1:112656515-112656537 GGGAAGCCAGTATTGCAAAGGGG 0: 1
1: 1
2: 0
3: 21
4: 187

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
912791499 Original CRISPR CTTGTCCAGTCCACCATAAT GGG (reversed) Intronic
No off target data available for this crispr