ID: 912791501

View in Genome Browser
Species Human (GRCh38)
Location 1:112656494-112656516
Sequence GACAAGTATAGAATTCCTGT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 130
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 123}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
912791499_912791501 -6 Left 912791499 1:112656477-112656499 CCCATTATGGTGGACTGGACAAG No data
Right 912791501 1:112656494-112656516 GACAAGTATAGAATTCCTGTTGG 0: 1
1: 0
2: 0
3: 6
4: 123
912791500_912791501 -7 Left 912791500 1:112656478-112656500 CCATTATGGTGGACTGGACAAGT 0: 1
1: 0
2: 0
3: 2
4: 76
Right 912791501 1:112656494-112656516 GACAAGTATAGAATTCCTGTTGG 0: 1
1: 0
2: 0
3: 6
4: 123

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
912791501 Original CRISPR GACAAGTATAGAATTCCTGT TGG Intronic
900888939 1:5435378-5435400 GCCAAGTACAGAAGTCTTGTAGG + Intergenic
904727848 1:32563404-32563426 GAAAAGGAGAGAAATCCTGTAGG - Intronic
908028961 1:59979825-59979847 CACAAATAAATAATTCCTGTTGG - Intergenic
911528862 1:99019740-99019762 GACAATTATACAAGTACTGTTGG + Intergenic
912676955 1:111690894-111690916 AAATAGTATAGAATTACTGTAGG + Intronic
912791501 1:112656494-112656516 GACAAGTATAGAATTCCTGTTGG + Intronic
916550612 1:165846348-165846370 TACAGGTATTGAATTCCTATGGG + Intronic
917566953 1:176222549-176222571 GACAAGAGTACAATTTCTGTGGG - Intergenic
917711744 1:177692396-177692418 AACTACTATAGACTTCCTGTTGG + Intergenic
921073293 1:211679918-211679940 GACATGTACAGAGTGCCTGTGGG - Intergenic
924032448 1:239900049-239900071 TACAAGGAAAGACTTCCTGTAGG + Intronic
1065977020 10:30850546-30850568 GATAAGTATAGAAATCCTTGGGG - Intronic
1067992353 10:51229053-51229075 GACAAGGTTAGGATTCCTGGAGG - Intronic
1073204255 10:101760454-101760476 GACGAGAATGGAATTGCTGTAGG - Intergenic
1074463747 10:113663970-113663992 GACGACCATAAAATTCCTGTGGG + Exonic
1077511276 11:2964855-2964877 GACAAGGACAGAATTCCAATAGG - Intronic
1079496176 11:21047078-21047100 TACAAGTATAGAATCACTGTTGG + Intronic
1079720629 11:23807958-23807980 GACAAGTGTAGAAATACTGATGG - Intergenic
1081096762 11:38945738-38945760 GACAAATATATAATGCATGTGGG + Intergenic
1088404436 11:109457580-109457602 CACAATTATAGTATTCCTGTGGG + Intergenic
1090876947 11:130798663-130798685 TAAAAGTAAAGAATTCCTTTTGG - Intergenic
1095846520 12:46751347-46751369 GATAAGCATAGAAGTGCTGTGGG - Intergenic
1098760260 12:74415566-74415588 CAGAAGCATAGAATTCCTGCAGG + Intergenic
1101191146 12:102333914-102333936 GACAAATATACAATTACAGTTGG - Intergenic
1106516730 13:30463042-30463064 AAATAGTATAAAATTCCTGTTGG - Intronic
1107014530 13:35697502-35697524 GACACTCATAAAATTCCTGTTGG - Intergenic
1107272466 13:38636010-38636032 TACAAGTATGGAATTCTTCTCGG - Intergenic
1109963353 13:69660303-69660325 GAAAAGAATTGAATTCCTGGGGG + Intergenic
1110537284 13:76666101-76666123 GAAAACTATAGATTTCCTTTTGG - Intergenic
1110869240 13:80431489-80431511 GACATGTATAGATTTGCTGCTGG - Intergenic
1111317907 13:86585283-86585305 GAAAACTATAGGATACCTGTAGG - Intergenic
1114488201 14:23077293-23077315 AACAAGTATAGAATAACTTTAGG + Intronic
1114712621 14:24793940-24793962 GAAAAGTATAGAACTGCTGAGGG - Intergenic
1114763465 14:25344136-25344158 GAAAAGAATTGCATTCCTGTGGG - Intergenic
1118127029 14:62916958-62916980 GAAAATTCTAGAATTCATGTGGG + Intronic
1118339543 14:64882575-64882597 GAAGAGTATAGAATACCTCTTGG + Intergenic
1118817814 14:69325194-69325216 GACAAGAATAGGATTCAGGTAGG + Intronic
1120646760 14:87083723-87083745 GTCAAGCATAGTCTTCCTGTTGG + Intergenic
1123143895 14:106109340-106109362 CCCAGGTATACAATTCCTGTGGG - Intergenic
1126792328 15:52232369-52232391 GAAAAGAAAAGAATTCCTGGTGG + Intronic
1128162043 15:65429642-65429664 GACAGGGCTAGAATTCTTGTAGG + Intergenic
1129435897 15:75540030-75540052 GTGAAGTATAGAATTCCTTATGG + Intronic
1129526678 15:76221366-76221388 GACAGGTATGGAATTCTTTTTGG + Intronic
1133151939 16:3840038-3840060 GGGATGTATATAATTCCTGTGGG - Intronic
1134291940 16:12908628-12908650 GAGAAGTCTGGAATTCCTGCAGG - Intronic
1139089558 16:63628958-63628980 GTAAAGTATACATTTCCTGTTGG - Intergenic
1143937499 17:10502157-10502179 GAAAAGTATTGGATTCCAGTGGG - Intronic
1147632450 17:41940864-41940886 GTTAAGTTTAGGATTCCTGTGGG - Intronic
1151198540 17:72450380-72450402 GACAAATATTGAATGCATGTGGG - Intergenic
1153223260 18:2880050-2880072 CATGAGGATAGAATTCCTGTTGG - Intronic
1153821775 18:8838218-8838240 GACAAGTATAAAATATCTATTGG - Intergenic
1154239850 18:12642798-12642820 GACAAATATGTAATGCCTGTGGG + Intronic
1156022242 18:32612980-32613002 GATAAGTGTAGAATTTCTGCTGG + Intergenic
1157652560 18:49349455-49349477 AACAAGTATAGAATTTATGGTGG + Intronic
1159128272 18:64250434-64250456 GACAAGGTTTGAACTCCTGTGGG - Intergenic
1159234448 18:65652759-65652781 GACAAATAAAGAATACCTTTTGG - Intergenic
1164499071 19:28797815-28797837 GACAAGAACTGAATTCCTATTGG - Intergenic
1168009957 19:53522051-53522073 CTCAAGAATAGAATTCCTTTTGG + Exonic
925158988 2:1669333-1669355 GACAAATATCCAATGCCTGTCGG + Intronic
926673299 2:15595801-15595823 GAGTAGTATAGAATTCAAGTGGG + Intronic
929820952 2:45272960-45272982 GAAAAGTTCAGAATTGCTGTTGG + Intergenic
933097263 2:78202423-78202445 GAAAAGTATAGACTTTCTCTGGG + Intergenic
933839939 2:86278473-86278495 GAGTTGTATAGAATTCTTGTTGG + Intronic
935464235 2:103377056-103377078 TAAAAGTATAGAATTTTTGTAGG - Intergenic
942128729 2:172855735-172855757 GACAAGTGTTGTTTTCCTGTTGG + Intronic
944146232 2:196510251-196510273 TACAAGTACAGAATTCCTAAGGG - Intronic
944834613 2:203566430-203566452 AACAAGTACAGAATTCGTATTGG + Intergenic
945309717 2:208296999-208297021 GAAAATTACAGTATTCCTGTTGG + Intronic
945826786 2:214730445-214730467 GAAAAGTATGAAATTCCTGAAGG - Exonic
947998756 2:234550082-234550104 AACCAGGATCGAATTCCTGTCGG - Intergenic
1169517731 20:6335843-6335865 GAAAAGTATACAATGCCAGTCGG - Intergenic
1170323058 20:15122673-15122695 GACATGTATAGAATGCATTTGGG - Intronic
1171225213 20:23436987-23437009 GGCAAGTGTGGGATTCCTGTTGG - Intergenic
1175627890 20:60504139-60504161 AACAAGTACAAAATTGCTGTGGG - Intergenic
1179005616 21:37511556-37511578 GAAAAGTAAAGACTTCCTTTTGG + Intronic
953700491 3:45191837-45191859 GATCAGTGTAGAATACCTGTGGG + Intergenic
956840051 3:73130938-73130960 TACAAGTTTACAATTACTGTTGG - Intergenic
960403753 3:117235085-117235107 GAAAAGTAGAGAATTGCAGTGGG - Intergenic
960671490 3:120159003-120159025 GACAACAGTAGAATTGCTGTCGG + Intergenic
971518275 4:27516136-27516158 GACAGGTATATACTTTCTGTGGG + Intergenic
971522594 4:27573132-27573154 GAAGAGTATACAATTTCTGTTGG + Intergenic
972945892 4:44254948-44254970 GACAAGTATAAAATTGCTCAGGG - Intronic
974278224 4:59755508-59755530 GACAAATACAGAAAACCTGTAGG + Intergenic
974308248 4:60170530-60170552 GACAAATATACAATTCTGGTGGG - Intergenic
974506788 4:62785184-62785206 ATCAATTATAGAATTCATGTTGG + Intergenic
975182235 4:71359710-71359732 AAAAATTATAGAATTACTGTAGG + Intronic
977190664 4:93996826-93996848 GATAATTATAGGATTGCTGTAGG + Intergenic
979211352 4:118107823-118107845 TACAAGTATAGGATATCTGTGGG + Intronic
979977243 4:127212106-127212128 GAGAAGGAAAGAATTCCTTTGGG - Intergenic
980473398 4:133278186-133278208 GAGAAGAATTGCATTCCTGTGGG - Intergenic
982891254 4:160853979-160854001 GAGAAGTATACAATTACAGTTGG + Intergenic
983576416 4:169266048-169266070 TCTAAGTAAAGAATTCCTGTTGG - Intronic
985130321 4:186732607-186732629 TACAAGGATACAAGTCCTGTTGG + Intergenic
989091564 5:37739292-37739314 GCCAAATATATAATTACTGTGGG - Intronic
990306122 5:54495518-54495540 AACAAGTAGAGAATTCAGGTGGG - Intergenic
992432771 5:76725780-76725802 CACAAGTATAATGTTCCTGTCGG + Intronic
997065421 5:130553957-130553979 GACAAGAAAACAAGTCCTGTGGG - Intergenic
997860645 5:137412258-137412280 GGCAGGTATAGAGCTCCTGTTGG + Intronic
1004188214 6:13440489-13440511 CACAAATAAAGAATTCATGTTGG - Intronic
1004755256 6:18603509-18603531 GACAAGAATAGAATGGCTGTTGG + Intergenic
1012343534 6:98157340-98157362 GAAAAGTGTAGTATTCCTGGTGG + Intergenic
1013442272 6:110182351-110182373 GACAAATGTACAATTACTGTGGG - Intronic
1015236445 6:130976760-130976782 GACAAGTATAGTAATCCAGCAGG + Intronic
1015378152 6:132534410-132534432 GAAAAGAATTGCATTCCTGTGGG + Intergenic
1016511032 6:144843536-144843558 GGCAAGTATAAAATTCCTATTGG + Intronic
1018428630 6:163705512-163705534 GACTAGCCCAGAATTCCTGTGGG + Intergenic
1027866638 7:83656596-83656618 GACAATGATATAATTCCTGCAGG + Intergenic
1027985220 7:85278729-85278751 AACAAATATAGACTTCCTGTAGG + Intergenic
1034134017 7:148748734-148748756 GCCAAGTATATAATTTCTGCTGG - Intronic
1036127339 8:6075131-6075153 GACAAATATCTAATGCCTGTGGG - Intergenic
1037151321 8:15638404-15638426 GACAATTACTGAGTTCCTGTAGG - Intronic
1040410285 8:47147210-47147232 AACAATGATAAAATTCCTGTGGG + Intergenic
1042885979 8:73552295-73552317 GACAAATGAAGAATTCCTTTTGG + Exonic
1050094577 9:2050809-2050831 GAGAAGTTTATGATTCCTGTAGG - Intronic
1050806645 9:9688386-9688408 GACAAGAATAGAATTTCCTTTGG + Intronic
1050809210 9:9722206-9722228 GATAAGTATAGGATTTCTTTTGG - Intronic
1056033276 9:82576411-82576433 GACAATTCTACAATTACTGTTGG + Intergenic
1058820404 9:108724149-108724171 GACAAAAATAAGATTCCTGTTGG + Intergenic
1185574290 X:1157825-1157847 GACAAGCATAGACTCCCTGGTGG + Intergenic
1185894552 X:3845872-3845894 AACAAGGTTAGAATTACTGTAGG - Intergenic
1185899670 X:3884296-3884318 AACAAGGTTAGAATTACTGTAGG - Intergenic
1185904786 X:3922725-3922747 AACAAGGTTAGAATTACTGTAGG - Intergenic
1187587582 X:20680966-20680988 GACAATGATAGAATTCTTGTTGG - Intergenic
1190141143 X:47846203-47846225 GACAACTTTATAATTCCAGTGGG - Exonic
1190444605 X:50511216-50511238 GACAAATATAGAATTATAGTTGG + Intergenic
1193443888 X:81576822-81576844 GAGAAGTGTAGATTTCCTGGGGG - Intergenic
1194127597 X:90039501-90039523 GACAAATGAAGAATTCCTTTTGG + Intergenic
1195802476 X:108728742-108728764 GACAAAAAAATAATTCCTGTGGG - Intronic
1199167178 X:144690798-144690820 GACAAGTATCAAATGCATGTGGG - Intergenic
1199763479 X:150923701-150923723 GACAAGGAAAGAATTGCTTTTGG + Intergenic