ID: 912791504

View in Genome Browser
Species Human (GRCh38)
Location 1:112656513-112656535
Sequence TTGGGAAGCCAGTATTGCAA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 171
Summary {0: 1, 1: 0, 2: 1, 3: 18, 4: 151}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
912791500_912791504 12 Left 912791500 1:112656478-112656500 CCATTATGGTGGACTGGACAAGT 0: 1
1: 0
2: 0
3: 2
4: 76
Right 912791504 1:112656513-112656535 TTGGGAAGCCAGTATTGCAAAGG 0: 1
1: 0
2: 1
3: 18
4: 151
912791499_912791504 13 Left 912791499 1:112656477-112656499 CCCATTATGGTGGACTGGACAAG No data
Right 912791504 1:112656513-112656535 TTGGGAAGCCAGTATTGCAAAGG 0: 1
1: 0
2: 1
3: 18
4: 151

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
912791504 Original CRISPR TTGGGAAGCCAGTATTGCAA AGG Intronic
900757950 1:4450455-4450477 CTTGGGAGTCAGTATTGCAATGG - Intergenic
902200586 1:14830620-14830642 ATGGGAAGCCAGTCTTCCCATGG + Intronic
903066273 1:20701480-20701502 TTGGGAAGTCAGGAATGCAGAGG + Intronic
903759058 1:25685069-25685091 TTGGAGAGCCAGTATTTTAAAGG + Intronic
905506150 1:38481154-38481176 TCGGGAAGCCAGTAGGGCATGGG - Intergenic
906547295 1:46628850-46628872 TGGGGAAGCCAGCCTTGCAGGGG + Intergenic
908816469 1:68040528-68040550 TTGGGAATAGAGTATTGCAAAGG - Intergenic
910247571 1:85157181-85157203 TCAGGAAGCCAGTTTTTCAATGG + Exonic
911978571 1:104535532-104535554 TTGGTAAGCCGGAATTGCAGTGG - Intergenic
912342995 1:108935974-108935996 GGGGAAAGCCAGTATTACAATGG - Intronic
912791504 1:112656513-112656535 TTGGGAAGCCAGTATTGCAAAGG + Intronic
913303792 1:117401545-117401567 TTTGGAAACCACTACTGCAATGG - Intronic
914710122 1:150205578-150205600 TTGGGAATAGAGCATTGCAATGG - Intergenic
915180840 1:154058059-154058081 GTGGGAAGGAAGTATTGAAATGG + Intronic
918494958 1:185125079-185125101 TGAGGAATCCAGTATTGAAAAGG + Exonic
919510552 1:198458209-198458231 TTGAGAAGCCTGTAGTGCAGTGG - Intergenic
919827611 1:201514604-201514626 TTGCGAAGCCAGTTTTCAAAAGG - Intergenic
921614106 1:217246334-217246356 TTGTGAAGCCAGTCTTGTCACGG + Intergenic
922760064 1:228123175-228123197 TTAGGAAGCCAGTCTTTCTAAGG + Intergenic
922820343 1:228480539-228480561 TTGGGAATAAAGCATTGCAATGG + Intergenic
923945700 1:238884764-238884786 TTAAGAAGCCACTGTTGCAAGGG - Intergenic
924303079 1:242659472-242659494 TTGGGAATACAGCATTGCAATGG + Intergenic
1064378230 10:14816276-14816298 TTGGGAATAGAGCATTGCAATGG - Intergenic
1065610331 10:27466098-27466120 TTGGGAAGCCAGCCTTCCCATGG + Intergenic
1072982173 10:100108023-100108045 TGGAGAAGTCAGTATTACAAAGG + Intergenic
1073102428 10:101013527-101013549 TTGGGAAGAAAGTGTTGCAAAGG + Intronic
1076524522 10:131103166-131103188 TTGGGAAGAGAGCATTGCAATGG + Intronic
1078900134 11:15634181-15634203 TTGGCAATCCAGTATTGACAAGG - Intergenic
1079530719 11:21449060-21449082 TTGGGTACCCAGTAGTGAAATGG + Intronic
1079656752 11:22994652-22994674 TTGGGAAGCCGGGATGGTAATGG + Intergenic
1080280573 11:30552247-30552269 CTGCGAAGCCAGAATGGCAAGGG + Intronic
1081335541 11:41861497-41861519 TTGGGAATAGAGTATTGCAATGG - Intergenic
1081557078 11:44174339-44174361 TTGGGAAACTTGCATTGCAATGG + Intronic
1086493273 11:87377088-87377110 TTTGCAACTCAGTATTGCAATGG - Intergenic
1086986327 11:93253489-93253511 TTGGGAATATAGTATTGCAATGG - Intergenic
1088249073 11:107847115-107847137 TTGTGAGTCCAGTATTTCAAAGG - Intronic
1088330782 11:108648531-108648553 TTGGGAAGGCTGTACTGAAAAGG - Intergenic
1093842737 12:23924405-23924427 ATGGGAAGCCAGATTTACAAAGG + Intronic
1094576651 12:31692626-31692648 TTGGGAATTCATTATAGCAACGG + Intronic
1096069695 12:48768101-48768123 TGGGGATGCAGGTATTGCAAAGG + Exonic
1103232674 12:119345011-119345033 TAGGGAAGATAGTATTACAAAGG - Intronic
1104108256 12:125683727-125683749 TTTGGGAGGCAGTGTTGCAAAGG - Intergenic
1104270878 12:127281104-127281126 TTTGGGAGACAGTGTTGCAAAGG + Intergenic
1105793263 13:23823940-23823962 TTGGTAAGGCAGTATAGCATAGG - Intronic
1107984514 13:45763909-45763931 TTTGGAATACAGCATTGCAATGG + Intergenic
1110207605 13:72934873-72934895 TTGGGAGGCAAGAATTCCAAAGG - Intronic
1110400808 13:75089447-75089469 TTGGGAATAGAGCATTGCAATGG - Intergenic
1110503618 13:76259052-76259074 TGGGGAAGACAGGAATGCAAGGG + Intergenic
1111216563 13:85150862-85150884 TTGTGAAACCATTATTGAAATGG - Intergenic
1112596201 13:100809479-100809501 TTGGGAAGAGAGCATTGCAACGG + Intergenic
1113315207 13:109172466-109172488 TTGAGAAGTCAGTATTGAAAAGG + Intronic
1114232304 14:20794622-20794644 TTGGGAATAAAGTATTGCAATGG + Intergenic
1121827953 14:97026247-97026269 TTGGTAAGCCTGTCTTGCAAAGG - Intergenic
1124992848 15:34692913-34692935 GTGGGAAGCCAGAAGAGCAACGG - Intergenic
1125097505 15:35871470-35871492 GTGGGAAGACAGGATTTCAAAGG + Intergenic
1131254705 15:90854441-90854463 TTGGGAAGCCAGAATGGGCACGG + Intergenic
1134380151 16:13716714-13716736 TTGGGAACAGAGCATTGCAATGG - Intergenic
1137781527 16:51101583-51101605 TTGGGAATTCTGTATTCCAAAGG + Intergenic
1138262718 16:55636846-55636868 ATGAGAAGCCAGAATTGCAGGGG + Intergenic
1139523266 16:67497462-67497484 TTGGGAAGCCAGTGCTGGAAAGG - Intergenic
1140565218 16:76034438-76034460 TTGGGAATAAAGTATTTCAAAGG - Intergenic
1142739216 17:1920974-1920996 TTTGGAAGCCAGTGTTCCCAGGG + Intergenic
1143717499 17:8785508-8785530 TTGGGCAGCCAGGCTTGGAAGGG + Intergenic
1147013371 17:37470271-37470293 TTGTGAAAGCAGTTTTGCAAAGG + Intronic
1147978165 17:44259648-44259670 TTGGGAAGCGAGAATGGGAAGGG - Intronic
1153117759 18:1680626-1680648 ATGGGAAGTCAGTGTTACAAAGG - Intergenic
1153997060 18:10452083-10452105 CTGGGAAGCAAGCATTGCTAGGG - Intergenic
1155207218 18:23570617-23570639 TTGGGAAGCAAATATTAAAAAGG - Intronic
1157922036 18:51723079-51723101 TCAGTAAGCCTGTATTGCAAAGG + Intergenic
1160152157 18:76403516-76403538 TTGGGAATCCAGGACTGCAGGGG + Intronic
1160195589 18:76752430-76752452 TTGGGAACAGAGCATTGCAATGG + Intergenic
1164418368 19:28065317-28065339 ATGGGAAGACTGTCTTGCAAGGG + Intergenic
1164758469 19:30708627-30708649 TTCTGAAGTCAGCATTGCAAAGG + Intronic
925048535 2:793158-793180 TTGGGAATTGAGCATTGCAATGG + Intergenic
927457928 2:23273388-23273410 TGGGGAAGCCAGTATTCAAGAGG - Intergenic
929235452 2:39600639-39600661 TTGGCAAGCCAGTCTGGAAAAGG + Intergenic
930840992 2:55845118-55845140 TTGGGAATAGAGCATTGCAATGG + Intergenic
931735595 2:65190606-65190628 GTGGGAAGCAAGTGTTGGAATGG - Intergenic
931983174 2:67715848-67715870 TTGGAAAGCCAGTTTGGAAAAGG + Intergenic
932420973 2:71601162-71601184 TGGTGAAGCCAGCAATGCAACGG - Intronic
937113561 2:119386514-119386536 TTGAGAAGGCAATATTGCCAAGG - Intergenic
937763226 2:125630481-125630503 TAGTGAAGCCAGGATTTCAAAGG - Intergenic
938668322 2:133562936-133562958 TTGGGAATCCAAAATTCCAAAGG + Intronic
939751514 2:146053114-146053136 TTGGGATGGCAGTATTGGAAGGG + Intergenic
940315315 2:152321938-152321960 TTGGGAGGCAAGAATTCCAAAGG - Intergenic
945287855 2:208100086-208100108 TTGGGAATGAAGCATTGCAATGG + Intergenic
945962824 2:216153436-216153458 ATGGGAAGCCATTAAAGCAAGGG + Intronic
946073741 2:217056344-217056366 TTCTGAAACCAGTATTCCAAAGG - Intergenic
948544288 2:238715977-238715999 TTGGGAATAGAGTATTGCAGTGG + Intergenic
1170735101 20:19007514-19007536 TTGGGAAGGGAGAATTGGAAAGG + Intergenic
1172472599 20:35211200-35211222 TTTGAAAACCAGTGTTGCAAAGG + Intergenic
1173261288 20:41438618-41438640 TTGGGACGCAAATATTTCAAAGG - Intronic
1177232656 21:18342581-18342603 AGGGGAAGTCAGTATTGCAGTGG - Intronic
1182634519 22:31714107-31714129 TTGAGAAGGCATTATTTCAATGG + Exonic
950571151 3:13800861-13800883 CATGGAAGCCAGTTTTGCAAAGG + Intergenic
951702641 3:25511593-25511615 TTGTGAAGGCAGTACTTCAAAGG + Intronic
957011804 3:75014223-75014245 ATGGGAAGGGAGTTTTGCAAGGG + Intergenic
959577974 3:107955322-107955344 TTGGGAATCGAGTATTGCAATGG - Intergenic
961175090 3:124828722-124828744 TTGGGAGGCCAGCACTGCGATGG - Intronic
961541404 3:127602447-127602469 TTGGGGAGGCAGTATGGCATGGG + Intronic
963054402 3:141173737-141173759 TTGGGAATAGGGTATTGCAATGG + Intergenic
963548949 3:146696891-146696913 TTGGAAAGCCACTTTTGCTAGGG + Intergenic
964182895 3:153908910-153908932 TTGGGGAGGCAGGATTGAAAAGG - Intergenic
964869054 3:161293093-161293115 TTGGGAAGAGAGCATTGCAATGG + Intergenic
964896406 3:161602054-161602076 TTGGGAAGGAAGCATTGCAATGG + Intergenic
969991364 4:11267127-11267149 TTGGAAGGCCAGTAGTGAAATGG - Intergenic
971365429 4:25973141-25973163 AGGGGAAGCCAGCATTGCTATGG + Intergenic
973795301 4:54419196-54419218 TTGTGAATAAAGTATTGCAATGG - Intergenic
974800015 4:66804856-66804878 TTGGGAAGCTAGCATTAAAAGGG - Intergenic
975688571 4:76943315-76943337 GTAGGAAGGCAGTCTTGCAACGG + Intergenic
975801111 4:78059280-78059302 TTGGGAAGCCAGCAAAGAAAAGG - Intronic
979825043 4:125222287-125222309 TTGGATATCCAGAATTGCAAAGG - Intergenic
981539090 4:145829811-145829833 ATGGAAAACCAGTATTGCAGTGG - Intronic
985610650 5:886200-886222 TTGGGCAGCCAGCATTGGCAGGG - Intronic
986341368 5:6792041-6792063 CTGGGAAGAGAGCATTGCAATGG + Intergenic
986432946 5:7699528-7699550 TTGGGATGTGAGTAATGCAATGG + Intronic
988129687 5:27086737-27086759 TTGTTAGGCCAGTATTGAAAAGG - Intronic
988225417 5:28405996-28406018 TTAGGGCACCAGTATTGCAAAGG - Intergenic
988226461 5:28418310-28418332 TTGGAAAGATAGCATTGCAATGG + Intergenic
989658664 5:43774305-43774327 GTGGGAAGTTAGTATAGCAATGG + Intergenic
990153878 5:52852112-52852134 TTGGGAAGCCACAAGAGCAAGGG + Intronic
991267940 5:64745009-64745031 TGGGGATGGCAGTATGGCAAGGG - Intronic
992321680 5:75619450-75619472 TTGGGAATAAAGCATTGCAACGG - Intronic
992638266 5:78746467-78746489 TTGGGAAGGCAGTGTTGGGATGG + Intronic
992831133 5:80594412-80594434 TTGGTCAGGCAGTAGTGCAATGG - Intergenic
995109736 5:108415593-108415615 TTGGGAATGGAGCATTGCAATGG - Intergenic
997784200 5:136692818-136692840 TTGGGAATACAGCATTGCAATGG + Intergenic
997784575 5:136697735-136697757 TTGGGAAGAGAGCACTGCAATGG + Intergenic
999350286 5:150863856-150863878 TGGGGAAGCTAGTTTTGAAAGGG + Intronic
1000883726 5:166726677-166726699 TTGGGAAGCCACCTTTACAAGGG + Intergenic
1003376581 6:5583857-5583879 TGGGGAAGTCTGTTTTGCAAGGG + Intronic
1008017655 6:46540152-46540174 TTGTGTAGCCTGTATTACAAAGG - Intergenic
1008418044 6:51266178-51266200 TTGGGAAACCAGTTTTCAAAAGG + Intergenic
1008460052 6:51758174-51758196 TTGGGAAGCCAGAACAGAAAAGG - Intronic
1011012144 6:82714689-82714711 ATGGGGAGCCAGTATTTCACAGG + Intergenic
1012262517 6:97104027-97104049 TTGGAAAGCCAGTATTAAAAGGG - Intronic
1014876842 6:126672077-126672099 TTGGGAAGCGGGGATTGCAGTGG + Intergenic
1020579811 7:9982422-9982444 TTGGGCATCCACTTTTGCAAGGG - Intergenic
1022189686 7:28005331-28005353 TTCGGAAGCCAGTTTTGTCAAGG + Intronic
1024189114 7:46987175-46987197 TTCAGAAGACAGTTTTGCAAAGG + Intergenic
1027807472 7:82847228-82847250 TAGGGATGCAAGTATTGGAATGG - Exonic
1028867777 7:95733409-95733431 TTGGGAAGCCCAAAGTGCAAAGG + Intergenic
1029328150 7:99827540-99827562 TTGGGAATAAAGCATTGCAATGG + Intergenic
1032667816 7:134054423-134054445 ATGGGAAGCAAGTAATGAAAGGG - Intronic
1036180699 8:6582105-6582127 ATGGGAAGCCTGTGTTGTAAAGG + Intronic
1042471151 8:69189469-69189491 ATGGGCAGGCAGGATTGCAAAGG - Intergenic
1042734089 8:71968428-71968450 TTGGGGAGGCACTATAGCAAGGG - Intronic
1044366400 8:91351864-91351886 ATGGGCAGCCAGTAAAGCAAAGG - Exonic
1051025598 9:12607148-12607170 TTGGAAGGACAGAATTGCAAAGG - Intergenic
1051220948 9:14847520-14847542 TTTGGAAGCCAGGAGTGCATAGG + Intronic
1052817697 9:33114306-33114328 TTGGGCAGCCAGGATGGCACAGG + Intronic
1054792039 9:69265517-69265539 TTGGGAACTCAGTATTTAAAGGG + Intergenic
1055426137 9:76198911-76198933 TTGGGAAGCTTGTAGTGCAAGGG - Intronic
1057078782 9:92156226-92156248 TTGGGAAGAGAGCATTGCAACGG + Intergenic
1058527849 9:105878146-105878168 TGGGGAAGCCAGCAGAGCAAGGG - Intergenic
1059656703 9:116364091-116364113 TTGGGCAACAAGTATTGCCATGG + Intronic
1060805726 9:126574975-126574997 TGGGGAGGCCACTATTGCTAGGG + Intergenic
1061063870 9:128265539-128265561 CTGGGAAGCCAGTATGCCAGGGG + Intronic
1186735882 X:12463428-12463450 TTAGAAAGGAAGTATTGCAAAGG - Intronic
1188890858 X:35610097-35610119 TTGGGAAGCCAGTCTTCCCTTGG + Intergenic
1189370431 X:40423738-40423760 TTGGAAAGCCAGTATTCAACAGG - Intergenic
1190879053 X:54479735-54479757 TTGGGAAGCCAGTTCTGTCAGGG + Intronic
1191896420 X:65998098-65998120 TTGGGGAGGCAGTATGGGAATGG + Intergenic
1196293907 X:113977644-113977666 TGGGGACTCCAGTATTTCAAGGG - Intergenic
1196362848 X:114887005-114887027 TTGGGGATACAGCATTGCAATGG + Intronic
1197136038 X:123060722-123060744 TGGTGGAGCCAGTATTGAAATGG - Intergenic
1198047147 X:132914036-132914058 TTAGTAAGTCAGTATTGAAAAGG - Intronic
1198920030 X:141715109-141715131 TGGGGGAGACAGTGTTGCAAAGG - Intergenic
1199456471 X:148035030-148035052 TTGGGAATAGAGTATTGTAATGG + Intergenic
1200274997 X:154723678-154723700 TTGGGAAGCCAAGATGGAAAAGG + Intronic
1201267179 Y:12218666-12218688 TTGGGAATGTAGCATTGCAATGG - Intergenic