ID: 912791505

View in Genome Browser
Species Human (GRCh38)
Location 1:112656514-112656536
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
912791500_912791505 13 Left 912791500 1:112656478-112656500 CCATTATGGTGGACTGGACAAGT 0: 1
1: 0
2: 0
3: 2
4: 76
Right 912791505 1:112656514-112656536 TGGGAAGCCAGTATTGCAAAGGG No data
912791499_912791505 14 Left 912791499 1:112656477-112656499 CCCATTATGGTGGACTGGACAAG No data
Right 912791505 1:112656514-112656536 TGGGAAGCCAGTATTGCAAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
No off target data available for this crispr