ID: 912791506

View in Genome Browser
Species Human (GRCh38)
Location 1:112656515-112656537
Sequence GGGAAGCCAGTATTGCAAAG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 210
Summary {0: 1, 1: 1, 2: 0, 3: 21, 4: 187}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
912791499_912791506 15 Left 912791499 1:112656477-112656499 CCCATTATGGTGGACTGGACAAG No data
Right 912791506 1:112656515-112656537 GGGAAGCCAGTATTGCAAAGGGG 0: 1
1: 1
2: 0
3: 21
4: 187
912791500_912791506 14 Left 912791500 1:112656478-112656500 CCATTATGGTGGACTGGACAAGT 0: 1
1: 0
2: 0
3: 2
4: 76
Right 912791506 1:112656515-112656537 GGGAAGCCAGTATTGCAAAGGGG 0: 1
1: 1
2: 0
3: 21
4: 187

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
912791506 Original CRISPR GGGAAGCCAGTATTGCAAAG GGG Intronic
902041587 1:13496534-13496556 GAGAAGCCAGTATGGTAAACTGG - Intronic
906547297 1:46628852-46628874 GGGAAGCCAGCCTTGCAGGGGGG + Intergenic
908829554 1:68165494-68165516 GGGAAGCCAGACCTGGAAAGAGG - Intronic
909091088 1:71226889-71226911 GGGAAGCCAGCACTGCAGAGAGG + Intergenic
911225400 1:95299377-95299399 GGAAAGACAGAATTGCAGAGAGG - Intergenic
911493222 1:98595376-98595398 AGGAAGTCAGTATATCAAAGAGG - Intergenic
911913419 1:103665510-103665532 GGGAAGCCAGTAATGCAATTAGG - Intronic
911915033 1:103686437-103686459 GGGAAGCCAGTAATGCAATTAGG + Intronic
911920834 1:103759648-103759670 GGGAAGCCAGTAATGCAATTAGG - Intergenic
912791506 1:112656515-112656537 GGGAAGCCAGTATTGCAAAGGGG + Intronic
912981482 1:114377789-114377811 GTGAAGCCAGTTTTCCCAAGGGG - Intergenic
914785836 1:150829921-150829943 GGGAAGCAAGTTTTGCCTAGTGG - Exonic
915447381 1:155981683-155981705 GGGAAGTCAGTACTGCCCAGGGG - Intronic
918339497 1:183556353-183556375 GAAAAGACAGTATTGCAAAGTGG + Intronic
920803291 1:209208993-209209015 TGGAAGCCAATATTACAAAATGG - Intergenic
922228510 1:223665963-223665985 GGTAAGCAGGTCTTGCAAAGAGG - Intergenic
922704805 1:227784574-227784596 AGGAAGTCAGTATATCAAAGAGG - Intergenic
923743545 1:236678753-236678775 GGGAAGGAAGGATTTCAAAGTGG - Intergenic
1062866555 10:860393-860415 GGTAAGGCAGTTTTCCAAAGTGG - Intronic
1064829755 10:19449616-19449638 GGGAAGCAAGAATTGCAATTTGG + Intronic
1064954559 10:20893441-20893463 GGGAAGTGAGTTGTGCAAAGAGG + Intronic
1066004697 10:31135421-31135443 GGGAATTCAGTATTGGAAAAGGG - Intergenic
1067464454 10:46486873-46486895 TGGAAGCAAGAATTGCAAATTGG - Intergenic
1067622742 10:47897784-47897806 TGGAAGCAAGAATTGCAAATTGG + Intergenic
1068944856 10:62719664-62719686 GGGAAGAAAGTGTTTCAAAGAGG - Intergenic
1070125689 10:73619855-73619877 GGGAAACCAGTTTTGTCAAGAGG - Intronic
1071689531 10:87802265-87802287 GTGAAGCCAGTTTTCCCAAGGGG - Intronic
1072982175 10:100108025-100108047 GAGAAGTCAGTATTACAAAGGGG + Intergenic
1074849660 10:117429342-117429364 GGAAAACTAGTTTTGCAAAGTGG - Intergenic
1075303371 10:121345392-121345414 GAGAAGCAAGTACAGCAAAGTGG + Intergenic
1075625675 10:123962925-123962947 GAGAACCCAGTGTTGCTAAGAGG - Intergenic
1078467955 11:11564223-11564245 GTGAAGGCAGTATAGCACAGTGG - Intronic
1080027089 11:27626389-27626411 GGGAGGCCACTGTAGCAAAGTGG - Intergenic
1081335539 11:41861495-41861517 GGGAATAGAGTATTGCAATGGGG - Intergenic
1081556216 11:44164454-44164476 GAGAAGCCAGTGTGGCATAGTGG - Intronic
1089717566 11:120377114-120377136 AGGAAGTCAGTATATCAAAGAGG - Intronic
1090657237 11:128855488-128855510 TTGAAGACATTATTGCAAAGAGG + Intronic
1091837407 12:3595378-3595400 GGGAAGCCTGTAATGCATAAGGG + Intergenic
1091841148 12:3621805-3621827 GGGAAGCCAGTTGTCCAGAGTGG - Intronic
1092013758 12:5139290-5139312 GGGAAGGTGGTATTTCAAAGTGG - Intergenic
1092069111 12:5618284-5618306 AGGAAGCCATTGGTGCAAAGAGG + Intronic
1095240928 12:39857989-39858011 GGGTAGCAAGTCTTGCCAAGTGG + Intronic
1095342448 12:41107509-41107531 AGGAAGTCAGTATATCAAAGAGG - Intergenic
1095870000 12:47016476-47016498 AGGAAACCAGTATATCAAAGAGG + Intergenic
1099251620 12:80262546-80262568 AGGAAGCCAGTGATCCAAAGAGG + Intronic
1100541264 12:95559702-95559724 GGGAAGAAAGTATTTCCAAGAGG - Intergenic
1102096546 12:110245931-110245953 TGGAGGCCAGAAGTGCAAAGTGG + Intergenic
1103232672 12:119345009-119345031 GGGAAGATAGTATTACAAAGGGG - Intronic
1105372095 13:19811014-19811036 GGGAAGCAAGAATTGCAATTTGG - Intergenic
1106086478 13:26546844-26546866 GAGAAGCCCACATTGCAAAGAGG + Intergenic
1108071890 13:46636743-46636765 GTGAAGACAGTGTTTCAAAGAGG - Intronic
1108232050 13:48355585-48355607 AGGAAGTCAGTATATCAAAGAGG + Intronic
1108671437 13:52693466-52693488 GAAAAGACAGTATTGCATAGTGG + Intronic
1109849970 13:68049887-68049909 GGGCAAACAGTTTTGCAAAGTGG + Intergenic
1110207603 13:72934871-72934893 GGGAGGCAAGAATTCCAAAGGGG - Intronic
1110714855 13:78689984-78690006 TGAAAGCCATTATGGCAAAGTGG + Intergenic
1117595482 14:57323129-57323151 AGGAAGCCAGTATAGGAAAAAGG - Intergenic
1118636395 14:67752199-67752221 GTGAGGCCATTATTGCAGAGGGG + Intronic
1119787290 14:77323043-77323065 CGGGAGCCAGCATTTCAAAGTGG - Intronic
1120180000 14:81333544-81333566 GGGAAGCCAGTATTCCAACCAGG + Intronic
1120653641 14:87163896-87163918 GGTAAGCCAGAATTCCAGAGAGG + Intergenic
1121937028 14:98029455-98029477 GGCAAGCCATTAATGCAGAGAGG + Intergenic
1123102143 14:105811479-105811501 GGGGAGCCAGAATGGCAGAGGGG - Intergenic
1124202744 15:27692438-27692460 GGTGAGCAAGTGTTGCAAAGGGG + Intergenic
1125043252 15:35216731-35216753 GGGAAGACAGTCATGCCAAGAGG + Intergenic
1125331494 15:38587045-38587067 GGGTAGGCAGTGTAGCAAAGTGG - Intergenic
1127013250 15:54653417-54653439 AGGAAGTCAATATTTCAAAGAGG + Intergenic
1127075628 15:55322665-55322687 CGGAAGCAAATATTGCAATGGGG - Intronic
1127503741 15:59578555-59578577 GGGAAGCCAGTAAGGGAAGGAGG + Intergenic
1127860975 15:62994201-62994223 GTGAAGCCATCATTGTAAAGCGG + Intergenic
1128739427 15:70073418-70073440 GGGAAGTCACTATTTCAAGGTGG - Intronic
1130687156 15:86048719-86048741 GGAATTCCAGCATTGCAAAGAGG - Intergenic
1130710778 15:86278965-86278987 GGGAAGAAAGTATTGTACAGTGG + Intronic
1130875895 15:88013989-88014011 AGGAAGCCAGTGCAGCAAAGTGG + Intronic
1131816300 15:96224382-96224404 GGGAAGGCAGCATGGCACAGAGG - Intergenic
1135909180 16:26543724-26543746 GGGAAGGAAGTATTGAGAAGAGG + Intergenic
1136577755 16:31134460-31134482 GGGAAGCCAGGATTGAAAGCCGG + Intronic
1140414201 16:74761866-74761888 AGGAGGCCAGTATTGAAAAAGGG + Intronic
1140715747 16:77723943-77723965 GGGAAGGCAGCTTTGCATAGTGG - Intronic
1141057844 16:80835121-80835143 GGGAAGCCAGTAGTACCCAGAGG + Intergenic
1141193460 16:81841929-81841951 GGGAAGCTGGTGTTGCAAGGTGG + Intronic
1142780727 17:2179180-2179202 GGGGAGCCAGGGTAGCAAAGGGG + Intronic
1146400690 17:32497971-32497993 GGAAAGCCAGAATTGCCAACGGG - Intronic
1146464204 17:33073500-33073522 GGGAAGCCTATCTTGCAAGGTGG + Intronic
1148291480 17:46454934-46454956 GGGAAGGCAGTATGGTTAAGAGG + Intergenic
1148313668 17:46672636-46672658 GGGAAGGCAGTATGGTTAAGAGG + Intronic
1149173315 17:53839873-53839895 GTGAAGCCAGTTTTCCCAAGCGG + Intergenic
1150597490 17:66619132-66619154 GGGAAACTAGTTTTGCAAACTGG + Intronic
1155118214 18:22791609-22791631 AGAAAGCCAGTATTAAAAAGAGG + Intergenic
1155942904 18:31817573-31817595 TGGAAGCCAGTGCTCCAAAGTGG + Intergenic
1157488020 18:48102880-48102902 GGGAAGCCAGCCTTTCAAAAAGG + Intronic
1157601714 18:48897099-48897121 AGGAAGCCACTATTGAAATGAGG + Intergenic
1158096568 18:53778762-53778784 GGGCAGCCAGCATGGCAAGGGGG + Intergenic
1160206656 18:76840159-76840181 GTAAAGCAAGTATTTCAAAGGGG + Intronic
1164571843 19:29380380-29380402 GGGAAGCCAGCACTGCAAAAGGG - Intergenic
1164962654 19:32448154-32448176 TGGTAGCCAATATTGCATAGTGG + Intronic
1165250296 19:34527352-34527374 AGGAAGTCAGTATATCAAAGAGG - Intergenic
927346499 2:22049778-22049800 GGGAAGCCACTATGGGAAAAGGG - Intergenic
930311551 2:49747268-49747290 GGGCAGTCAGTTTTGCAAAGTGG + Intergenic
932420971 2:71601160-71601182 GTGAAGCCAGCAATGCAACGGGG - Intronic
933817551 2:86080330-86080352 AGGAAGGCAGTATTGCAGAGTGG - Intronic
935763412 2:106342371-106342393 GGGAAGCCAGGAGGGAAAAGAGG + Intergenic
937016660 2:118611950-118611972 GGGAGGCCAGCATGGCAGAGAGG + Intergenic
938313730 2:130312283-130312305 GGGAAGGCAATATTGAGAAGAGG - Intergenic
939651721 2:144770893-144770915 GGCATGCCAGTAATGAAAAGGGG - Intergenic
939804356 2:146754189-146754211 GGCAAGGCCATATTGCAAAGTGG + Intergenic
941722407 2:168825955-168825977 GTGAAGCCAGTATAGCACAGTGG + Intronic
942659751 2:178251876-178251898 GGGAATCCAGCATTTCAAAAGGG - Intronic
942893752 2:181023661-181023683 GGGCATCCAATATAGCAAAGGGG + Intronic
943263943 2:185701297-185701319 GGGAAGCAAGAATTGCAATTTGG - Intergenic
949055567 2:241926497-241926519 GGGAAGCCCACATTGCCAAGAGG + Intergenic
1168896602 20:1328147-1328169 GAGAAGCCAGTTGTGCAGAGAGG + Intronic
1169112755 20:3044318-3044340 GAGATGCCAGTTTTCCAAAGTGG + Intronic
1169311833 20:4549207-4549229 ATGAAGGCAGTATGGCAAAGTGG - Intergenic
1169660088 20:7969048-7969070 GGGAAGCCAGCATTGGACACGGG - Intergenic
1171726212 20:28623487-28623509 GGGAGGACAGAATTGCAATGTGG - Intergenic
1174812007 20:53654095-53654117 GGGAAGGCTGTTTTGAAAAGAGG - Intergenic
1176303881 21:5113586-5113608 GGGGAGCCAGTAATACAAAGAGG + Intergenic
1176690313 21:9899936-9899958 GGGAAGCCTGCATTGTAAACCGG + Intergenic
1177206925 21:18021029-18021051 GAGAAGTCAGTATTTCAAAACGG - Intronic
1177920006 21:27141088-27141110 GGAAAGCCTGTATTTAAAAGTGG + Intergenic
1178332938 21:31715805-31715827 AGGATGACAGTATTGCTAAGTGG - Intronic
1178618963 21:34157940-34157962 GGGAAGCCAGGGTGGGAAAGAGG + Intergenic
1179853149 21:44148364-44148386 GGGGAGCCAGTAATACAAAGAGG - Intergenic
1182138363 22:27929258-27929280 AGGAAGGCAGTATAGCAAAGTGG - Intergenic
1182519385 22:30876690-30876712 GGGGAGCCAGGATGGGAAAGGGG + Intronic
949242943 3:1892788-1892810 AGGAAGTCAGTATATCAAAGAGG + Intergenic
952020292 3:29010443-29010465 GGGATGCCAGTGTCACAAAGTGG + Intergenic
953109246 3:39917902-39917924 TGGAAGTCAGTAATCCAAAGTGG - Intronic
954156566 3:48688184-48688206 AGGAAGCCAGTATGGCCAGGTGG - Exonic
958707673 3:97676322-97676344 GTGAAGGAAGTATTTCAAAGAGG + Intronic
960550850 3:118974624-118974646 GGGAAGCCAGTCATGGAATGTGG - Intronic
964708576 3:159647151-159647173 GAGAAGACATTAGTGCAAAGGGG + Intronic
967855192 3:194112150-194112172 GGGAATCCAGTGATGAAAAGTGG + Intergenic
968601081 4:1509600-1509622 GGGCAGCCAGGACTGCACAGTGG - Intergenic
969346681 4:6574831-6574853 GGGATGCAGGTATTGCGAAGAGG + Intergenic
971693101 4:29863701-29863723 AGGAAGCCAGTTTTCCCAAGGGG - Intergenic
972274265 4:37542236-37542258 GGGAAGACACTTTTGCATAGTGG - Intronic
975106901 4:70577819-70577841 TGGAAGACAGAAGTGCAAAGAGG - Intergenic
976743672 4:88382463-88382485 GGGAAGACAGAATAGCAAAATGG + Intronic
980353723 4:131717851-131717873 GGGAAGCCTGCATTGTAAACTGG + Intergenic
983600860 4:169525749-169525771 GATAAGGCAGCATTGCAAAGTGG - Intronic
984237749 4:177181388-177181410 GGGAAACCAGTATTGCAAAGAGG + Intergenic
984928832 4:184828583-184828605 TGGGAGGCAGTATTGCATAGTGG + Intergenic
985434315 4:189914216-189914238 GGGAGGACAGAATTGCAATGTGG + Intergenic
987101176 5:14592371-14592393 GGGAAGGCAGTAATGTACAGTGG + Intronic
987450687 5:18080186-18080208 GGGAAGCCAGGATTTCAATGTGG - Intergenic
987476030 5:18393452-18393474 GGGAAGCAATTATAGCAAAATGG + Intergenic
989132317 5:38119580-38119602 GGGGAGACATTATTGCAAATTGG + Intergenic
990103609 5:52226798-52226820 GTGAAGAAAGTATAGCAAAGAGG - Intergenic
992749948 5:79852651-79852673 GGGAAGGGAGCTTTGCAAAGGGG + Intergenic
992838379 5:80662849-80662871 GGGAAGCAAGAATTGCAATTTGG + Intronic
996526006 5:124480326-124480348 AGGAAGTCAGTATGGAAAAGTGG - Intergenic
996990198 5:129620824-129620846 GAGAAGCCAGTGTGGCAAAGTGG + Intronic
998014844 5:138723966-138723988 AGGAAGCCAGTGTTGAAAACAGG + Intronic
999505710 5:152193687-152193709 GGGAAGGGAGAATTCCAAAGTGG - Intergenic
1001373020 5:171225610-171225632 GGGAAGCCAGTGGAGGAAAGAGG + Intronic
1001992482 5:176129418-176129440 GGAAAGACAGTATTGGCAAGTGG - Intronic
1002296764 5:178235709-178235731 GGGAAGCCAGTAGTGGGAAAAGG - Intergenic
1003599060 6:7501268-7501290 GGGATGCTGGTATTGGAAAGAGG + Intergenic
1003701309 6:8467835-8467857 GGCAAGGCAATTTTGCAAAGTGG + Intergenic
1005876189 6:30011457-30011479 GGGAGGACAGTTTTGAAAAGTGG + Intergenic
1006270991 6:32967693-32967715 GGGAAGCCAGTTCTGCAAATTGG + Intronic
1011263851 6:85495738-85495760 GGGAATCTACAATTGCAAAGTGG - Exonic
1011390609 6:86848478-86848500 GGGAAGACAGAATTGCAATTTGG - Intergenic
1012115737 6:95295793-95295815 GGGAAACCAGTATTGAAATAAGG - Intergenic
1012908867 6:105097285-105097307 AGGAAACCAGGATTGGAAAGAGG + Exonic
1014306161 6:119745169-119745191 GGGAAATCAGTATTATAAAGTGG - Intergenic
1017317420 6:153047853-153047875 GAGAAGAAAGTATTTCAAAGAGG - Intronic
1018573543 6:165234758-165234780 GGGAAGGAAGAATTTCAAAGAGG - Intergenic
1019489797 7:1306972-1306994 GGAAGGCCAGTATGGCAGAGGGG + Intergenic
1021068736 7:16210392-16210414 GCGAACCCAGTACAGCAAAGGGG + Intronic
1022555909 7:31295820-31295842 GTGATGCCAATATTGCCAAGAGG - Intergenic
1023059595 7:36315074-36315096 GGGAAGACAGGAGTGCAATGTGG + Intergenic
1024574296 7:50751566-50751588 GGGAAGGAAGAACTGCAAAGGGG + Intronic
1026730347 7:72906236-72906258 GGGAAGCCACTGTTGCTGAGAGG + Intronic
1027113626 7:75460880-75460902 GGGAAGCCACTGTTGCTGAGAGG - Intronic
1027285875 7:76645475-76645497 GGGAAGCCACTGTTGCTGAGAGG - Intergenic
1028915316 7:96252652-96252674 GTGAAGTGAGTATTGCAAAAAGG + Intronic
1031609206 7:123805456-123805478 GGGAAGTGAGAATTGAAAAGTGG + Intergenic
1031802182 7:126260789-126260811 GGGATTCCAGGATTGAAAAGAGG - Intergenic
1032591381 7:133194868-133194890 ACGAAGCCAGTAATGGAAAGGGG + Intergenic
1033282183 7:140014122-140014144 GAGAAGACTGGATTGCAAAGAGG + Intronic
1036987975 8:13557875-13557897 GGGAAGCAAGAATTGCAACTCGG + Intergenic
1038017270 8:23525770-23525792 GGGAAGCCAGTTTGGCAGTGTGG - Intergenic
1040859329 8:51983095-51983117 GGGAAGCAAGAATTGCAACTCGG - Intergenic
1042236834 8:66621671-66621693 TGGAAGCCAGAAGTGCAAAAAGG + Intergenic
1044214599 8:89594239-89594261 AGGTTGCCAGTATTGGAAAGAGG + Intergenic
1046456883 8:114477342-114477364 AGGAAACCAGTATATCAAAGAGG + Intergenic
1047161102 8:122380642-122380664 TGGAAGCCAGTTTTGCAACATGG + Intergenic
1053723403 9:40972376-40972398 GGGAGGACAGAATTGCAATGTGG + Intergenic
1054342562 9:63879620-63879642 GGGAGGACAGAATTGCAATGTGG - Intergenic
1056102351 9:83311857-83311879 GGAAAGCCAGTTTTCCAAAGAGG + Intronic
1056731940 9:89173317-89173339 GGAAAGCCAGTCTTGCAAGTGGG + Intronic
1058527847 9:105878144-105878166 GGGAAGCCAGCAGAGCAAGGGGG - Intergenic
1060538734 9:124414902-124414924 TGGAAGCCGATTTTGCAAAGAGG - Exonic
1060873002 9:127057632-127057654 AGGGAGCCAATATTCCAAAGTGG - Intronic
1062192921 9:135256955-135256977 GGGAAGACACTTTTACAAAGAGG - Intergenic
1062452006 9:136619751-136619773 GGGGTGCCAGTAGTGCAAGGCGG - Intergenic
1192735191 X:73844084-73844106 GGGCACCCACTATTGAAAAGAGG + Intergenic
1193943661 X:87707123-87707145 GGGAAGCCAGAAGTACAATGTGG + Intergenic
1195888366 X:109666261-109666283 GGAAAGACATTATTGAAAAGTGG + Intronic
1196006194 X:110839792-110839814 AGGAAGCCAGTATTGTGAAGAGG - Intergenic
1196671563 X:118373672-118373694 GAGGAGGCAGTATTGCGAAGTGG + Intronic
1197161943 X:123333755-123333777 GGGAAGCAAGGAAAGCAAAGAGG - Intronic
1197836657 X:130701719-130701741 TAGGAGCCAGTATTGCAGAGTGG - Intronic
1198541416 X:137644029-137644051 GTGGAGCCAGCATAGCAAAGTGG - Intergenic
1198594451 X:138221121-138221143 TGGAAGACAGTATAGCAAAGTGG - Intergenic
1198979056 X:142374101-142374123 GGAAAGCCAGGATTCCAATGCGG - Intergenic
1202083696 Y:21112482-21112504 GGGAAGACAGAATTGCAATTTGG + Intergenic