ID: 912792504

View in Genome Browser
Species Human (GRCh38)
Location 1:112665973-112665995
Sequence ATCCTATTATAGGTGACACA CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
912792504_912792506 9 Left 912792504 1:112665973-112665995 CCGTGTGTCACCTATAATAGGAT No data
Right 912792506 1:112666005-112666027 ATTCTTTTTTTTCCCTAAGATGG No data
912792504_912792507 10 Left 912792504 1:112665973-112665995 CCGTGTGTCACCTATAATAGGAT No data
Right 912792507 1:112666006-112666028 TTCTTTTTTTTCCCTAAGATGGG No data
912792504_912792508 11 Left 912792504 1:112665973-112665995 CCGTGTGTCACCTATAATAGGAT No data
Right 912792508 1:112666007-112666029 TCTTTTTTTTCCCTAAGATGGGG 0: 1
1: 0
2: 20
3: 144
4: 1352

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
912792504 Original CRISPR ATCCTATTATAGGTGACACA CGG (reversed) Intronic
No off target data available for this crispr