ID: 912796588

View in Genome Browser
Species Human (GRCh38)
Location 1:112697118-112697140
Sequence CAGTCCCAGATGAAGTTTTC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 156
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 144}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
912796585_912796588 3 Left 912796585 1:112697092-112697114 CCTAGAGGCTAGGGTGTGTCTGG 0: 1
1: 0
2: 3
3: 17
4: 203
Right 912796588 1:112697118-112697140 CAGTCCCAGATGAAGTTTTCAGG 0: 1
1: 0
2: 0
3: 11
4: 144

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
912796588 Original CRISPR CAGTCCCAGATGAAGTTTTC AGG Intronic
904368520 1:30033967-30033989 CAGCCCCAGAAGAAGCCTTCAGG + Intergenic
904606355 1:31699988-31700010 CACTCCCAGAGGAAGGTTGCAGG + Intronic
905024769 1:34842352-34842374 CAGTCACAGATCATTTTTTCTGG - Intronic
905212155 1:36381784-36381806 CAGTCCCAGTTCAAGTTCTAAGG + Intronic
905354511 1:37372095-37372117 AAGTCCCACATCAAGATTTCTGG + Intergenic
906008254 1:42498321-42498343 CAGTGCAAGATGAAGAGTTCTGG + Intronic
908013166 1:59803954-59803976 AAGTCACAGATGAAGTTTTTAGG + Intergenic
908035217 1:60044325-60044347 CAGCCACAGACTAAGTTTTCTGG + Intronic
908517114 1:64904310-64904332 CATTCCCAAATTATGTTTTCTGG + Intronic
908818540 1:68058431-68058453 CAGGCCCACCTGCAGTTTTCTGG + Intergenic
910528591 1:88210109-88210131 ATGCCCCAGATGAAGTTTTGTGG - Intergenic
910735326 1:90447573-90447595 CAATCCAAGATGAATTTTTGTGG + Intergenic
911972484 1:104455005-104455027 CTGTCTGAGATGAAGTTCTCAGG - Intergenic
912796588 1:112697118-112697140 CAGTCCCAGATGAAGTTTTCAGG + Intronic
919344576 1:196359213-196359235 CAGTCCCCGATGAAACTTTGAGG - Intronic
919814098 1:201426847-201426869 CAGCCCCACATGAAGGTTTGTGG + Intronic
920581546 1:207113034-207113056 GAGCCCCAGATGGAGTTTTTGGG - Exonic
1063762130 10:9091585-9091607 CAGTCCCACATAATGTATTCTGG - Intergenic
1063875689 10:10475501-10475523 TACTTCCAGATCAAGTTTTCAGG + Intergenic
1065100223 10:22324499-22324521 CAGTCACACAAGAAGTTTTCTGG + Intronic
1065916664 10:30358857-30358879 AAGTCACAGATGAAGCTTTGGGG - Intronic
1066440405 10:35433405-35433427 CAGTACCATAAGAAGATTTCAGG + Intronic
1069700489 10:70421268-70421290 CAGTCCCTGAGGAATATTTCAGG - Intronic
1072892128 10:99333013-99333035 CAGTCCAAGATCAAGGTGTCTGG + Intronic
1076316909 10:129548722-129548744 CAGTCCCACCTGCAGCTTTCGGG + Intronic
1078747895 11:14132680-14132702 GGGACCCAGATGGAGTTTTCTGG - Intronic
1080629902 11:34064863-34064885 CAGCCACAGTTCAAGTTTTCTGG + Intronic
1086160700 11:83718905-83718927 TAGTCCCAGCTGCAGTTGTCTGG - Intronic
1090859258 11:130638567-130638589 CAGTCCCAGATGAATTCATTTGG + Intergenic
1099864125 12:88257436-88257458 CATGCCCAGAGGAAGTTTTCAGG + Intergenic
1110600897 13:77372510-77372532 CAGTCAGAGTTGAAGTTGTCTGG - Intergenic
1113171846 13:107513240-107513262 CTGTCCTAGATGATGCTTTCTGG + Intronic
1114536178 14:23424355-23424377 GAGGTCCAGATGAAGATTTCTGG - Intronic
1115702600 14:35969374-35969396 CAATCCCAGGTGAACTTTTCTGG + Intergenic
1120191872 14:81446943-81446965 CATTCCCAGAGGATGTTCTCTGG - Intergenic
1122193116 14:100063584-100063606 CAGTCACAGTTGAAGATTTCAGG + Intronic
1132025274 15:98399733-98399755 CAGTCCCAGATGGAGGTGCCAGG - Intergenic
1134187250 16:12094382-12094404 AAGGCCCAGATGTTGTTTTCAGG - Intronic
1135924492 16:26680667-26680689 CAGTCCCAGAAGAGTTTATCAGG - Intergenic
1137493874 16:48954118-48954140 AAGTGCCATTTGAAGTTTTCTGG + Intergenic
1137637288 16:49997743-49997765 AAGTCCCAGATGAAGATTCCAGG - Intergenic
1137822230 16:51457262-51457284 CATCTCCAAATGAAGTTTTCAGG + Intergenic
1138034141 16:53585870-53585892 CAGGCCCAGATGATTTTTTAGGG - Intergenic
1138836890 16:60448269-60448291 TAGTGCCAGGTGAACTTTTCAGG - Intergenic
1138988855 16:62365655-62365677 CATTCCCAGCAGAAGTTGTCTGG + Intergenic
1143318462 17:6051349-6051371 AAGTCCCAGATCAAGGTGTCAGG - Intronic
1147470574 17:40656094-40656116 CAGTCTCTGATGAAGTTTCAAGG + Exonic
1149957469 17:61068693-61068715 GAATCCCAGAAGAAGTTTTAGGG - Intronic
1153496700 18:5706655-5706677 AAGTCCCAGATGGAGGATTCAGG + Intergenic
1160204436 18:76822040-76822062 CAGTCCCAGATGGCGGTTCCGGG + Exonic
1160436516 18:78856416-78856438 CTACCCCAGAGGAAGTTTTCGGG + Intergenic
1162624600 19:11874553-11874575 AAGTCCCAGAAGTAATTTTCTGG + Intronic
926551515 2:14307083-14307105 CAGACCCACATGATGTTTTAAGG + Intergenic
927001819 2:18803443-18803465 CAGTGCCAGGTGGAGTTCTCAGG - Intergenic
927726642 2:25429532-25429554 CAGTCCCTGCTGAAGTGATCAGG - Intronic
930505877 2:52282459-52282481 CACTTCAAAATGAAGTTTTCAGG - Intergenic
930885325 2:56319374-56319396 ACGTTCCAGATGATGTTTTCAGG + Intronic
930938635 2:56986008-56986030 TACTCACAAATGAAGTTTTCTGG - Intergenic
932777741 2:74538456-74538478 CAGTCCCTCTTGAAGTTATCAGG + Intronic
934477300 2:94602196-94602218 CAGGCCCACCTGAAGTTTTGGGG - Intronic
935639124 2:105274203-105274225 CAGTCCCTGAGTAAGTTTCCGGG + Intronic
937128588 2:119490080-119490102 CTGTCCCAGACGCAGTTTCCGGG + Intronic
941361006 2:164551454-164551476 TAGTCCCAGATGATGATATCTGG + Intronic
1169055876 20:2620495-2620517 GAGTCCCACATGATCTTTTCTGG - Intronic
1170221931 20:13950573-13950595 CTGTTCCAGATGAAAATTTCAGG - Intronic
1170816282 20:19717227-19717249 CAGTCCCAGATAGAGGGTTCAGG + Intronic
1170826206 20:19798247-19798269 CAGTCCCAGATGAGTTGCTCAGG - Intergenic
1172657236 20:36544638-36544660 CAGTCCCAGATGAAGACTCTCGG + Intronic
1174079666 20:47962059-47962081 CTATCCCAGAGGATGTTTTCAGG + Intergenic
1178666295 21:34549914-34549936 CAGACCCAGGTGAAGTTCTGAGG + Intronic
1179101943 21:38361779-38361801 CAGTCCCAGAAAAAATTGTCAGG - Intergenic
1180569824 22:16704304-16704326 GAGACCCAGACGTAGTTTTCTGG + Intergenic
1181045596 22:20212890-20212912 CAGGCCCTGAGGCAGTTTTCAGG + Intergenic
1185227901 22:49663655-49663677 CTGTCCCTGATGAAGTTGCCTGG - Intergenic
951634414 3:24757227-24757249 CAGGACCACATGAAGTTTTCTGG - Intergenic
954624724 3:52016242-52016264 CAGTCCCACATGACCTTTCCAGG - Intergenic
955513464 3:59704570-59704592 GAGACCCAGAACAAGTTTTCTGG - Intergenic
956020196 3:64925811-64925833 CAGGCCCAGGTGAAGCTTTGTGG - Intergenic
956444267 3:69310126-69310148 CAGTCCAGAATCAAGTTTTCAGG + Intronic
958934737 3:100244221-100244243 AAGGCTCAGATGACGTTTTCAGG + Intergenic
958950702 3:100412509-100412531 AAGTCCCAGAAAAAGTATTCTGG - Intronic
959055267 3:101561640-101561662 CCGGCCCAGAAGAAGTTTTTAGG + Intergenic
960899021 3:122535539-122535561 CAGTCACTAATGAAGATTTCTGG - Intronic
961171490 3:124800826-124800848 CAGTATCAGTTGAAGTTCTCAGG - Intronic
964931820 3:162034167-162034189 AAGTTCCATATGAAGTGTTCAGG - Intergenic
965411577 3:168338307-168338329 TAGTCCCAGATGCAGCTTGCTGG + Intergenic
967249290 3:187520399-187520421 GAGTCTCACATGAAGTTCTCTGG + Intergenic
970777938 4:19699158-19699180 CAGTCCCAGAAGCATTTTTGTGG - Intergenic
971477675 4:27087693-27087715 CAGCTCCAGATGAAGTTTGTTGG - Intergenic
971929747 4:33065429-33065451 CAGCTCCAGATGAGTTTTTCAGG - Intergenic
972124930 4:35752397-35752419 CAGTACCACATGAATTTCTCAGG + Intergenic
974303938 4:60107020-60107042 CAGTGCCAGATACAGTTTCCTGG + Intergenic
976800624 4:88987555-88987577 CAGCCTCAGATTAAGTTTTTTGG - Intronic
982408062 4:155043272-155043294 CTGTCACAGATGAGGTTCTCTGG - Intergenic
986092778 5:4526647-4526669 CAATTCAAGATGAAGTTTTGGGG - Intergenic
986562691 5:9078563-9078585 CATACCCAGCTGAAATTTTCTGG - Intronic
988704747 5:33714003-33714025 CAAGCCCACATGAAGATTTCAGG - Intronic
989709243 5:44377078-44377100 GAGTCAAACATGAAGTTTTCAGG - Intronic
995840230 5:116436897-116436919 CATTCCCAGATGAAGAGTCCAGG - Intergenic
995889968 5:116940195-116940217 GAGTCCCAGCTGAAGTGATCTGG - Intergenic
995995587 5:118294484-118294506 CAGTATCAGGTTAAGTTTTCAGG + Intergenic
1000011488 5:157237559-157237581 AAGACACTGATGAAGTTTTCAGG + Intronic
1000540932 5:162538697-162538719 TAGTCCCATATGGAGTTTTTTGG - Intergenic
1001429345 5:171647176-171647198 CAGACCCTGATGGAGTTCTCAGG + Intergenic
1004559027 6:16729443-16729465 GAGTCCCAGATGCAGTTTCAGGG - Intronic
1004670252 6:17789116-17789138 CAAACCAAGATGAAGCTTTCTGG - Intronic
1006800252 6:36755195-36755217 CAGACCTAGAAGAGGTTTTCAGG - Intronic
1006806047 6:36789914-36789936 CAGTCACATATGAATTTTTTTGG + Intronic
1007302691 6:40880041-40880063 CAGTCCCAGATGATGGTCGCTGG + Intergenic
1007615694 6:43178825-43178847 CTGTCCCAGATGATGCTGTCAGG - Exonic
1007782868 6:44264287-44264309 CAGACCCAGATGGAGTTTGGTGG - Intronic
1008231159 6:48986430-48986452 CAACCCAACATGAAGTTTTCTGG + Intergenic
1008941739 6:57053730-57053752 CAGTTCCAAATGATGATTTCAGG - Exonic
1009624370 6:66120159-66120181 CAGTCCTGGGTGAAGTTTTCTGG - Intergenic
1009663062 6:66638503-66638525 CATTACCAGATGAAGCTTACAGG - Intergenic
1009792175 6:68417909-68417931 CTCTCCCACATGAATTTTTCTGG - Intergenic
1012365049 6:98428814-98428836 CAGTGCAAAATGAAGTCTTCGGG + Intergenic
1012408914 6:98933484-98933506 CAGCCTCAGTTGAAGATTTCAGG - Intronic
1015380643 6:132563658-132563680 CAGTCCCATAGATAGTTTTCAGG + Intergenic
1019693917 7:2433861-2433883 CAGTCTCGGAGGAGGTTTTCGGG - Exonic
1024428696 7:49261028-49261050 CAGTAACAGTTGCAGTTTTCAGG + Intergenic
1025960795 7:66219461-66219483 CTCTCCCAGATGAAATCTTCAGG + Intronic
1026067068 7:67084089-67084111 CATTCCCAGGTAAAGCTTTCAGG - Intronic
1026617950 7:71923889-71923911 CAGTCCAAGATTAGGATTTCAGG + Intronic
1027578125 7:79956820-79956842 CAGTTCCAGCTGAAATTTGCTGG - Intergenic
1027857969 7:83537166-83537188 AAGTCCAAGATCAAGTTTCCAGG - Intronic
1028138710 7:87248378-87248400 CTGTGCCAGATGAGATTTTCAGG + Intergenic
1031896420 7:127354126-127354148 AATTGGCAGATGAAGTTTTCAGG - Intronic
1035070761 7:156143634-156143656 AGGTCCCAGATGCAGCTTTCAGG - Intergenic
1035392079 7:158511095-158511117 AAATGCCAGATGAAATTTTCTGG + Intronic
1037063916 8:14552391-14552413 AATGCACAGATGAAGTTTTCAGG - Intronic
1037427357 8:18770688-18770710 AAGTCCCAGAGGAAGTGTTTGGG + Intronic
1044333790 8:90952268-90952290 CAGTTGCAGATGTAATTTTCAGG + Intronic
1046237269 8:111441582-111441604 CAGTGCCAGCTGTAGTTTGCTGG + Intergenic
1047926104 8:129684077-129684099 CAGGCACAAATGATGTTTTCAGG - Intergenic
1049012701 8:139897970-139897992 AGGTCACACATGAAGTTTTCTGG + Intronic
1051330855 9:16023778-16023800 CTGTCACAGCTGAGGTTTTCTGG + Intronic
1051404879 9:16726826-16726848 CAATCCAAGATGAAAGTTTCTGG + Intronic
1051544893 9:18262728-18262750 CATACCCCGATGAACTTTTCTGG - Intergenic
1052852670 9:33387366-33387388 CAGGCCCACCTGAAGTTTTGGGG + Intronic
1053282519 9:36830187-36830209 AAGTCCAAGATGAAGGTGTCAGG - Intergenic
1053680769 9:40483917-40483939 CAGGCCCACCTGAAGTTTTGGGG + Intergenic
1053930755 9:43112229-43112251 CAGGCCCACCTGAAGTTTTGGGG + Intergenic
1054282944 9:63141018-63141040 CAGGCCCACCTGAAGTTTTGGGG - Intergenic
1054293851 9:63319432-63319454 CAGGCCCACCTGAAGTTTTGGGG + Intergenic
1054391876 9:64623921-64623943 CAGGCCCACCTGAAGTTTTGGGG + Intergenic
1054503853 9:65892407-65892429 CAGGCCCACCTGAAGTTTTGGGG - Intronic
1058093649 9:100834461-100834483 CAGTCCCAAATGATGTTTCCTGG + Intergenic
1060838504 9:126776484-126776506 AAGTCCAAGATGAAGGTATCTGG + Intergenic
1186215788 X:7299726-7299748 CAGTCCAGGATGAAGTGTTTTGG + Intronic
1190142281 X:47858351-47858373 CATTCCCAAATGAAGAGTTCTGG - Intronic
1191610169 X:63103296-63103318 CAGTCCCAGATGGAATTATGAGG + Intergenic
1194134636 X:90125578-90125600 CAGTCCAAGATGTAGATTTCTGG - Intergenic
1196225804 X:113165212-113165234 CATTTCCATCTGAAGTTTTCAGG - Intergenic
1200480418 Y:3695690-3695712 CAGTCCAAGATGTAGATTTCTGG - Intergenic
1200839692 Y:7768399-7768421 CAGTCCCACATACAGTTGTCTGG + Intergenic