ID: 912801503

View in Genome Browser
Species Human (GRCh38)
Location 1:112722590-112722612
Sequence CTGTAGTGAGAGAGGCCCTC GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
912801494_912801503 13 Left 912801494 1:112722554-112722576 CCTTTGCTCACCTCTCCTTCCAG No data
Right 912801503 1:112722590-112722612 CTGTAGTGAGAGAGGCCCTCGGG No data
912801500_912801503 -6 Left 912801500 1:112722573-112722595 CCAGGCTGGAAGGTGTTCTGTAG No data
Right 912801503 1:112722590-112722612 CTGTAGTGAGAGAGGCCCTCGGG No data
912801498_912801503 3 Left 912801498 1:112722564-112722586 CCTCTCCTTCCAGGCTGGAAGGT No data
Right 912801503 1:112722590-112722612 CTGTAGTGAGAGAGGCCCTCGGG No data
912801493_912801503 14 Left 912801493 1:112722553-112722575 CCCTTTGCTCACCTCTCCTTCCA 0: 1
1: 0
2: 4
3: 82
4: 745
Right 912801503 1:112722590-112722612 CTGTAGTGAGAGAGGCCCTCGGG No data
912801499_912801503 -2 Left 912801499 1:112722569-112722591 CCTTCCAGGCTGGAAGGTGTTCT 0: 1
1: 0
2: 1
3: 12
4: 181
Right 912801503 1:112722590-112722612 CTGTAGTGAGAGAGGCCCTCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
912801503 Original CRISPR CTGTAGTGAGAGAGGCCCTC GGG Intronic
No off target data available for this crispr