ID: 912806766

View in Genome Browser
Species Human (GRCh38)
Location 1:112763037-112763059
Sequence GATTTCCTCTGATGCTTTTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
912806766_912806769 -3 Left 912806766 1:112763037-112763059 CCAGAAAAGCATCAGAGGAAATC No data
Right 912806769 1:112763057-112763079 ATCTCTGAAGGAATTTCTCAGGG No data
912806766_912806776 18 Left 912806766 1:112763037-112763059 CCAGAAAAGCATCAGAGGAAATC No data
Right 912806776 1:112763078-112763100 GGGTTGTCTGGGAACTGTGGGGG No data
912806766_912806770 -2 Left 912806766 1:112763037-112763059 CCAGAAAAGCATCAGAGGAAATC No data
Right 912806770 1:112763058-112763080 TCTCTGAAGGAATTTCTCAGGGG No data
912806766_912806774 16 Left 912806766 1:112763037-112763059 CCAGAAAAGCATCAGAGGAAATC No data
Right 912806774 1:112763076-112763098 AGGGGTTGTCTGGGAACTGTGGG No data
912806766_912806768 -4 Left 912806766 1:112763037-112763059 CCAGAAAAGCATCAGAGGAAATC No data
Right 912806768 1:112763056-112763078 AATCTCTGAAGGAATTTCTCAGG No data
912806766_912806773 15 Left 912806766 1:112763037-112763059 CCAGAAAAGCATCAGAGGAAATC No data
Right 912806773 1:112763075-112763097 CAGGGGTTGTCTGGGAACTGTGG No data
912806766_912806775 17 Left 912806766 1:112763037-112763059 CCAGAAAAGCATCAGAGGAAATC No data
Right 912806775 1:112763077-112763099 GGGGTTGTCTGGGAACTGTGGGG No data
912806766_912806771 6 Left 912806766 1:112763037-112763059 CCAGAAAAGCATCAGAGGAAATC No data
Right 912806771 1:112763066-112763088 GGAATTTCTCAGGGGTTGTCTGG No data
912806766_912806772 7 Left 912806766 1:112763037-112763059 CCAGAAAAGCATCAGAGGAAATC No data
Right 912806772 1:112763067-112763089 GAATTTCTCAGGGGTTGTCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
912806766 Original CRISPR GATTTCCTCTGATGCTTTTC TGG (reversed) Intergenic
No off target data available for this crispr