ID: 912814448

View in Genome Browser
Species Human (GRCh38)
Location 1:112817897-112817919
Sequence CTGTGGGTCAGGCCCTCACA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
912814448_912814462 17 Left 912814448 1:112817897-112817919 CCCTGTGAGGGCCTGACCCACAG No data
Right 912814462 1:112817937-112817959 GCAAGGTGGGGGTGTTGATGGGG No data
912814448_912814460 15 Left 912814448 1:112817897-112817919 CCCTGTGAGGGCCTGACCCACAG No data
Right 912814460 1:112817935-112817957 AGGCAAGGTGGGGGTGTTGATGG No data
912814448_912814459 6 Left 912814448 1:112817897-112817919 CCCTGTGAGGGCCTGACCCACAG No data
Right 912814459 1:112817926-112817948 CAAGGAAAAAGGCAAGGTGGGGG No data
912814448_912814456 3 Left 912814448 1:112817897-112817919 CCCTGTGAGGGCCTGACCCACAG No data
Right 912814456 1:112817923-112817945 TAGCAAGGAAAAAGGCAAGGTGG No data
912814448_912814455 0 Left 912814448 1:112817897-112817919 CCCTGTGAGGGCCTGACCCACAG No data
Right 912814455 1:112817920-112817942 CTATAGCAAGGAAAAAGGCAAGG No data
912814448_912814461 16 Left 912814448 1:112817897-112817919 CCCTGTGAGGGCCTGACCCACAG No data
Right 912814461 1:112817936-112817958 GGCAAGGTGGGGGTGTTGATGGG No data
912814448_912814457 4 Left 912814448 1:112817897-112817919 CCCTGTGAGGGCCTGACCCACAG No data
Right 912814457 1:112817924-112817946 AGCAAGGAAAAAGGCAAGGTGGG No data
912814448_912814458 5 Left 912814448 1:112817897-112817919 CCCTGTGAGGGCCTGACCCACAG No data
Right 912814458 1:112817925-112817947 GCAAGGAAAAAGGCAAGGTGGGG No data
912814448_912814454 -5 Left 912814448 1:112817897-112817919 CCCTGTGAGGGCCTGACCCACAG No data
Right 912814454 1:112817915-112817937 CACAGCTATAGCAAGGAAAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
912814448 Original CRISPR CTGTGGGTCAGGCCCTCACA GGG (reversed) Intergenic
No off target data available for this crispr