ID: 912816300

View in Genome Browser
Species Human (GRCh38)
Location 1:112831418-112831440
Sequence CTGGATTATACCGGATATGT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
912816286_912816300 13 Left 912816286 1:112831382-112831404 CCCACCTGGCATCCCACCGGGAC No data
Right 912816300 1:112831418-112831440 CTGGATTATACCGGATATGTGGG No data
912816291_912816300 0 Left 912816291 1:112831395-112831417 CCACCGGGACTGGACAGCCCCCA 0: 30
1: 44
2: 29
3: 36
4: 161
Right 912816300 1:112831418-112831440 CTGGATTATACCGGATATGTGGG No data
912816289_912816300 9 Left 912816289 1:112831386-112831408 CCTGGCATCCCACCGGGACTGGA No data
Right 912816300 1:112831418-112831440 CTGGATTATACCGGATATGTGGG No data
912816287_912816300 12 Left 912816287 1:112831383-112831405 CCACCTGGCATCCCACCGGGACT No data
Right 912816300 1:112831418-112831440 CTGGATTATACCGGATATGTGGG No data
912816283_912816300 22 Left 912816283 1:112831373-112831395 CCATGTGGACCCACCTGGCATCC No data
Right 912816300 1:112831418-112831440 CTGGATTATACCGGATATGTGGG No data
912816290_912816300 1 Left 912816290 1:112831394-112831416 CCCACCGGGACTGGACAGCCCCC 0: 29
1: 35
2: 18
3: 25
4: 100
Right 912816300 1:112831418-112831440 CTGGATTATACCGGATATGTGGG No data
912816292_912816300 -3 Left 912816292 1:112831398-112831420 CCGGGACTGGACAGCCCCCACTG 0: 36
1: 24
2: 15
3: 39
4: 176
Right 912816300 1:112831418-112831440 CTGGATTATACCGGATATGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
912816300 Original CRISPR CTGGATTATACCGGATATGT GGG Intergenic
No off target data available for this crispr