ID: 912822737

View in Genome Browser
Species Human (GRCh38)
Location 1:112880852-112880874
Sequence AAGCAGCTTCAGAGTGGGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
912822732_912822737 -9 Left 912822732 1:112880838-112880860 CCACTTTCTAAAAGAAGCAGCTT No data
Right 912822737 1:112880852-112880874 AAGCAGCTTCAGAGTGGGGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
912822737 Original CRISPR AAGCAGCTTCAGAGTGGGGA GGG Intergenic
No off target data available for this crispr