ID: 912823395

View in Genome Browser
Species Human (GRCh38)
Location 1:112885036-112885058
Sequence CTGTGGGTGATGAGCCAGGT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
912823385_912823395 22 Left 912823385 1:112884991-112885013 CCTTGATTCCAAAGAGTGAATTT No data
Right 912823395 1:112885036-112885058 CTGTGGGTGATGAGCCAGGTGGG No data
912823387_912823395 14 Left 912823387 1:112884999-112885021 CCAAAGAGTGAATTTATTGGATG No data
Right 912823395 1:112885036-112885058 CTGTGGGTGATGAGCCAGGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
912823395 Original CRISPR CTGTGGGTGATGAGCCAGGT GGG Intergenic
No off target data available for this crispr