ID: 912823395 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 1:112885036-112885058 |
Sequence | CTGTGGGTGATGAGCCAGGT GGG |
Strand | + |
Crispr in exon? | No |
Crispr in intron? | No |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | No data | |||
Summary | No data |
Found 2 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
912823385_912823395 | 22 | Left | 912823385 | 1:112884991-112885013 | CCTTGATTCCAAAGAGTGAATTT | No data | ||
Right | 912823395 | 1:112885036-112885058 | CTGTGGGTGATGAGCCAGGTGGG | No data | ||||
912823387_912823395 | 14 | Left | 912823387 | 1:112884999-112885021 | CCAAAGAGTGAATTTATTGGATG | No data | ||
Right | 912823395 | 1:112885036-112885058 | CTGTGGGTGATGAGCCAGGTGGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
912823395 | Original CRISPR | CTGTGGGTGATGAGCCAGGT GGG | Intergenic | ||
No off target data available for this crispr |