ID: 912827971

View in Genome Browser
Species Human (GRCh38)
Location 1:112923732-112923754
Sequence TGCCCTCCTGGTGCAGCTGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 352
Summary {0: 1, 1: 0, 2: 5, 3: 30, 4: 316}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
912827971_912827977 15 Left 912827971 1:112923732-112923754 CCACCAGCTGCACCAGGAGGGCA 0: 1
1: 0
2: 5
3: 30
4: 316
Right 912827977 1:112923770-112923792 GCCTCTCCAACTATGCCACCTGG 0: 1
1: 1
2: 3
3: 5
4: 113
912827971_912827975 -7 Left 912827971 1:112923732-112923754 CCACCAGCTGCACCAGGAGGGCA 0: 1
1: 0
2: 5
3: 30
4: 316
Right 912827975 1:112923748-112923770 GAGGGCAAGTTCCTGGATCTTGG 0: 1
1: 1
2: 2
3: 23
4: 154
912827971_912827981 22 Left 912827971 1:112923732-112923754 CCACCAGCTGCACCAGGAGGGCA 0: 1
1: 0
2: 5
3: 30
4: 316
Right 912827981 1:112923777-112923799 CAACTATGCCACCTGGGAAGTGG 0: 1
1: 1
2: 3
3: 12
4: 152
912827971_912827979 16 Left 912827971 1:112923732-112923754 CCACCAGCTGCACCAGGAGGGCA 0: 1
1: 0
2: 5
3: 30
4: 316
Right 912827979 1:112923771-112923793 CCTCTCCAACTATGCCACCTGGG 0: 1
1: 1
2: 4
3: 9
4: 189

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
912827971 Original CRISPR TGCCCTCCTGGTGCAGCTGG TGG (reversed) Intronic
900970465 1:5989877-5989899 TGCCCTCCTAGTACAGCAGGGGG - Intronic
901016136 1:6232358-6232380 TGCTCTCCTGCTACAGCTGATGG + Intronic
901059490 1:6465536-6465558 GCTCCTCCTGGTGCTGCTGGGGG - Exonic
901221676 1:7587035-7587057 TCCCCTTCTGGGGGAGCTGGTGG - Intronic
901266492 1:7914346-7914368 TGCCCTCCTGGTGCTCACGGTGG - Intergenic
901646284 1:10718487-10718509 TGCCCTCCTTGGGGAGCAGGTGG - Intronic
901792490 1:11661688-11661710 TGCCCTGATGGTGCAGGTGCAGG + Exonic
901876287 1:12168649-12168671 TGCAGTCCTGGAGTAGCTGGAGG + Intronic
902360604 1:15940870-15940892 TGGCCTCCTGGGGCCCCTGGGGG + Intergenic
902409558 1:16205161-16205183 TGCACTCCTGCACCAGCTGGGGG + Exonic
902609343 1:17588149-17588171 CGGGCTCCTGGAGCAGCTGGGGG + Intronic
902864784 1:19270744-19270766 TCACCTCCTGGTGCAGCTGGTGG + Intergenic
902867003 1:19286181-19286203 TCACCTCCTGGTGCAGCTGGTGG + Exonic
902870057 1:19308451-19308473 TCACCTCCTGGTGCAGCCGCTGG + Exonic
903510035 1:23868059-23868081 TGCCCGCCTGGGGCAGCGAGTGG - Exonic
903585908 1:24415271-24415293 TGCCCTCCTGGAACACCTGTCGG - Intronic
903642287 1:24868244-24868266 AGCCCTCCGGGTGCTGCTCGTGG + Intergenic
903732081 1:25503974-25503996 TGCCCTCTGGTGGCAGCTGGGGG - Intergenic
903755457 1:25657443-25657465 TGCCTTCCTCTTGCAGCCGGAGG + Intronic
904002262 1:27345490-27345512 TGCCCGCCTGCGCCAGCTGGAGG + Exonic
904377849 1:30092997-30093019 TGACCTCCTGGAGGAGCTAGGGG + Intergenic
905034873 1:34911490-34911512 TGCCCGAATGGTGAAGCTGGGGG + Intronic
907091643 1:51730213-51730235 TGCCCTCTCGGTGGAACTGGAGG - Intronic
909869589 1:80722782-80722804 TGCCTTCCAGGGGCAGCTTGTGG + Intergenic
912827971 1:112923732-112923754 TGCCCTCCTGGTGCAGCTGGTGG - Intronic
914222187 1:145691171-145691193 TTCCCCATTGGTGCAGCTGGGGG - Intronic
914321962 1:146573517-146573539 TGCCCTCCTGGTCAGGCTGTAGG + Intergenic
915439145 1:155933778-155933800 TCCCCACCTGGGGCCGCTGGCGG + Exonic
918243109 1:182637279-182637301 TGAGCTCCTGGAGAAGCTGGAGG - Intergenic
920211694 1:204333133-204333155 TTCCCGCCTGGTGGAGCTGGGGG - Intronic
920432767 1:205929263-205929285 TGCCTTCCTGGTGCTGGTGAAGG - Exonic
920555359 1:206900318-206900340 TGCCCGGCTGCTGCAGCAGGAGG + Exonic
921930239 1:220748675-220748697 TGCCCACCTGCTGCAGCCGCCGG - Exonic
922605797 1:226889108-226889130 TGCCCTCCTTGTGCAGCACTGGG - Intronic
1063544430 10:6966612-6966634 TGCCCACCTGGTTCTGCTGGTGG - Intergenic
1065800191 10:29344802-29344824 TGCCCTCCTGGGGGAGGTGGGGG + Intergenic
1069602633 10:69717792-69717814 AGCCATCCTGGGGGAGCTGGAGG - Intergenic
1072615366 10:97046120-97046142 AGCCCTCCTGGGGCAGATGGAGG + Intronic
1073250033 10:102115424-102115446 TGAAATCCTGGAGCAGCTGGGGG + Intronic
1073912195 10:108359180-108359202 TGCCCTCTAGGGTCAGCTGGTGG - Intergenic
1074385922 10:113016688-113016710 TGCCCTGCTGGTGGAGAGGGAGG + Intronic
1075440244 10:122474469-122474491 TGCCCCCCTGGTGCAGGAGGAGG - Intronic
1075907887 10:126098071-126098093 TGCCCTCGTCATGCAGCTGTTGG - Intronic
1076155315 10:128200415-128200437 TGCCCACCTGATGCAGCCAGAGG + Intergenic
1076378968 10:130012075-130012097 TGCACTGCTGGTGCAGCACGGGG - Intergenic
1076649706 10:131979476-131979498 TGCCCTCCTGGTGAAGACAGTGG + Intronic
1076725894 10:132412935-132412957 TGCCATCTTGGGTCAGCTGGCGG + Intronic
1076852370 10:133099368-133099390 TGCCCTCCTGGTGACTCAGGCGG - Intronic
1077266953 11:1655566-1655588 TGCCCTGCTGGTCCAGCATGCGG - Intergenic
1077407459 11:2388997-2389019 TGTCCTCCTGGAGCAGCAGGGGG + Intronic
1077464887 11:2729071-2729093 TGCCCGCCTGGGGCAGGCGGGGG - Intronic
1077575342 11:3378898-3378920 GGCCGCCATGGTGCAGCTGGAGG + Intronic
1077800036 11:5528027-5528049 TGCCCTTCTAGTGGGGCTGGTGG - Intronic
1077888107 11:6401119-6401141 TGCCCTGCTGGTGGGGCTGCGGG - Intronic
1079862078 11:25685900-25685922 TGTCCTCCTGGTGGAGGTGCTGG + Intergenic
1079920423 11:26427289-26427311 TGCCATCAAGGTGCAGGTGGAGG - Intronic
1081380406 11:42407685-42407707 AGCCCTCCTGCTGCAGCTTCAGG - Intergenic
1081807650 11:45899267-45899289 GGCTCTGCTGGTGCAGCTGGGGG - Intronic
1082030129 11:47597810-47597832 TGCCCTCCTGGTAGGCCTGGAGG - Intergenic
1083325117 11:61869251-61869273 TGCCCTCCTGGTGGACCCGCTGG + Intergenic
1083486269 11:62984657-62984679 TGACCTCCTGCAGCAGGTGGGGG - Exonic
1083651815 11:64208557-64208579 TGGCCTCCTGGAGCAGCAGCGGG + Intronic
1084044637 11:66561577-66561599 GGCTCTCCTGCAGCAGCTGGTGG - Exonic
1084089509 11:66870737-66870759 GCCCCGCCTGGGGCAGCTGGAGG - Intronic
1085533354 11:77204290-77204312 TACCCTCCTGAGGCAGCTGCTGG + Intronic
1088619914 11:111671333-111671355 TGCCAAGCTGGTGGAGCTGGAGG - Intronic
1091394002 12:142596-142618 ATCCCTCCTGGAGCTGCTGGTGG + Intronic
1091696332 12:2630569-2630591 TGTCTTCATGGTCCAGCTGGAGG + Intronic
1091703656 12:2679752-2679774 TGCCATCCGGGTGCAGGAGGTGG + Exonic
1091750907 12:3020740-3020762 TGCCTTCCTGGAGCAGCAGCAGG + Exonic
1092401499 12:8182520-8182542 TGCCCTCCTGCAGCCTCTGGAGG - Intronic
1093073668 12:14734648-14734670 TGCCATCCAGATGCAGATGGAGG - Intergenic
1094343407 12:29439027-29439049 TGCCCTCCTAGTGGAGATAGTGG - Intronic
1095952452 12:47789290-47789312 TGCTCTGCTGTTGCAGCTGCCGG + Exonic
1096377393 12:51124579-51124601 GGCCCTCATGGGGCAGCCGGAGG + Intronic
1101865530 12:108517086-108517108 GGCCCTGCTGCTGCCGCTGGGGG + Exonic
1103471414 12:121184720-121184742 TGCCCAGCTGCTGCCGCTGGAGG + Exonic
1103702570 12:122855438-122855460 TGGCCTCATGCTGCAGCTGGAGG - Intronic
1104400382 12:128471228-128471250 TCCCCTCCAGGTGGAGTTGGGGG + Intronic
1104810882 12:131619785-131619807 TGCTCTCCTGCTGCAGGGGGAGG + Intergenic
1104952794 12:132449839-132449861 TGCCCTCCTGGGGCCCCCGGAGG - Intergenic
1105240078 13:18600328-18600350 TTCCGCCCTGCTGCAGCTGGAGG + Intergenic
1105437062 13:20388563-20388585 TGCCCTTCAAGTTCAGCTGGTGG - Intergenic
1107141087 13:36999273-36999295 TCCGCTTCTGTTGCAGCTGGCGG - Exonic
1108577649 13:51803688-51803710 TGTCTTCGTGGTGCTGCTGGCGG - Intronic
1109936148 13:69287317-69287339 TCCACTCCTGGGGCAGCTGTTGG + Intergenic
1112339126 13:98537969-98537991 TCCGCTCGGGGTGCAGCTGGAGG + Intronic
1113858511 13:113464674-113464696 GGCCCACGTGGGGCAGCTGGAGG + Intronic
1113900681 13:113795132-113795154 TCTCCTTCTGTTGCAGCTGGTGG + Exonic
1114255868 14:21001025-21001047 TGCTGTCCTGGGGCTGCTGGAGG + Exonic
1115505792 14:34092995-34093017 TGCCCTCCTGGGGTAGCGGTAGG - Intronic
1118071336 14:62249625-62249647 TGCCATACTGCTGCTGCTGGGGG - Intergenic
1118241292 14:64060979-64061001 TGCCATGCTGCTGCTGCTGGGGG + Intronic
1118316004 14:64726554-64726576 GGCCCACCTGGAGCAGCCGGGGG - Intronic
1120795562 14:88629612-88629634 TGGCCTCCTGGAACAGGTGGAGG - Intronic
1121613658 14:95298344-95298366 TGCCCTTCTGATGCAGCGGCAGG - Intronic
1122165743 14:99822500-99822522 TGCCCTCATCCTCCAGCTGGGGG - Intronic
1122939591 14:104975282-104975304 TGCCCACCTGGTGCAGCTCAGGG - Intronic
1123491161 15:20783757-20783779 TTCCGCCCTGCTGCAGCTGGAGG - Intergenic
1123547663 15:21352848-21352870 TTCCGCCCTGCTGCAGCTGGAGG - Intergenic
1124240752 15:28025708-28025730 TGCCCTCACGGAGCAGCCGGTGG - Intronic
1124424895 15:29555651-29555673 TGCCTGCCTGGCGCAGGTGGGGG - Intronic
1124499202 15:30211939-30211961 TGGCTTCCTGGTGCTGCAGGTGG - Intergenic
1124744377 15:32326731-32326753 TGGCTTCCTGGTGCTGCAGGTGG + Intergenic
1125462667 15:39920932-39920954 TGCGCGCCTGGGGCAGCCGGGGG + Intergenic
1125757028 15:42071153-42071175 AGTAGTCCTGGTGCAGCTGGAGG + Exonic
1126550984 15:49929072-49929094 AGCCCTCCTGGTGACGCTGATGG + Intronic
1128380317 15:67107478-67107500 TGCCCTCCTGATGCAGTCTGTGG + Intronic
1129894232 15:79091649-79091671 CGCCCTCCCGGTGCAGCATGCGG - Intergenic
1131543815 15:93299043-93299065 TGGCCTCCTGGTGCAACGCGCGG + Intergenic
1132303290 15:100789591-100789613 TGCCCTCCTGGCACAGGGGGAGG - Intergenic
1202955993 15_KI270727v1_random:80078-80100 TTCCGCCCTGCTGCAGCTGGAGG - Intergenic
1132516510 16:368536-368558 GGTCCTCGGGGTGCAGCTGGGGG + Exonic
1133021878 16:2970353-2970375 TGCCCGCCTGGGGCAGCTCAAGG - Intronic
1136360687 16:29777726-29777748 TGCCCACCTAGAGCTGCTGGTGG + Intergenic
1137553951 16:49458534-49458556 TGCCATCCTTGGGCAGCAGGTGG - Intergenic
1138162345 16:54766111-54766133 TGCCCTCTTTGTGCAGTTGCTGG + Intergenic
1138553704 16:57760438-57760460 TGCCCACCCGGGCCAGCTGGAGG + Intronic
1139582141 16:67880087-67880109 TGCCATCCAGCTGCAGCTTGGGG - Exonic
1141158523 16:81613242-81613264 TGCCCTACTGATGAAGCAGGAGG - Intronic
1141206790 16:81939040-81939062 TGCCCACATGGTTCAGCTTGAGG + Intronic
1141409820 16:83825415-83825437 TGCCCTGCTGTTGGAGCTGTGGG - Intergenic
1141503806 16:84462050-84462072 GTCCATCCTGGGGCAGCTGGCGG + Exonic
1141568543 16:84920068-84920090 TCCCAGCCTGGTGCAGTTGGAGG - Intronic
1141967035 16:87452629-87452651 TGTCATCCCTGTGCAGCTGGTGG - Intronic
1142285030 16:89168190-89168212 TGGCCGCCAGGGGCAGCTGGTGG + Intergenic
1142313328 16:89326851-89326873 TGCCCGCCAGGGGCTGCTGGTGG + Intronic
1142805668 17:2369928-2369950 TTGCCTCCTGGTGGAGCTGAAGG + Intronic
1142970932 17:3611076-3611098 TCTCCTCCCGCTGCAGCTGGTGG + Intronic
1142992267 17:3739313-3739335 TGCCCTCCTGGTGCTCTTAGGGG - Intronic
1143408716 17:6695868-6695890 TGCCCTCAAGGTGCTGCAGGAGG - Exonic
1144729721 17:17519470-17519492 AGTCCTCCTGGGGTAGCTGGAGG - Intronic
1144959811 17:19038746-19038768 TCCCCTCCTGCTGCAGCCTGTGG - Intronic
1144975349 17:19135778-19135800 TCCCCTCCTGCTGCAGCCTGTGG + Intronic
1145017117 17:19406470-19406492 GGCCCTCAGGGTGCTGCTGGGGG - Intergenic
1145197679 17:20908816-20908838 GGCCCTCCTGCTGCTGCTCGCGG + Intergenic
1146701090 17:34961093-34961115 TTCTCGCCTGGTGCAGGTGGAGG - Intronic
1146938345 17:36826300-36826322 TGCCATCCTGGGGCAGGAGGGGG + Intergenic
1147535021 17:41315271-41315293 TGTCCCCCTGGAGCAGATGGAGG + Exonic
1149582843 17:57763214-57763236 TGTGCTCCTGGTGAAGCAGGTGG - Intergenic
1151166972 17:72212249-72212271 TGCCCTCCTGGCTCAGCGTGGGG + Intergenic
1151967194 17:77437588-77437610 TGACCTCCTGATGCTTCTGGTGG + Intronic
1152068640 17:78124616-78124638 TGCCCTCCTGCTGCTGCTGCTGG - Exonic
1152268914 17:79312447-79312469 TGCCCTCACAGTGCATCTGGTGG - Intronic
1152312671 17:79560384-79560406 TGCCCTCCCTGTCCTGCTGGCGG + Intergenic
1152719210 17:81914690-81914712 TGCCTTCCAGGTGCAGCATGTGG - Exonic
1152829849 17:82490565-82490587 GGCCCTGCTGGGGCAGCAGGTGG - Intergenic
1152895456 17:82908239-82908261 TGCTCTCCTGGTGGAGTTGGGGG + Intronic
1153514600 18:5891868-5891890 TGGGATCCTGGTGCTGCTGGTGG - Exonic
1154448753 18:14458446-14458468 TTCCGCCCTGCTGCAGCTGGAGG - Intergenic
1156128494 18:33938135-33938157 TGGCTTTCTCGTGCAGCTGGTGG + Intronic
1158393030 18:57059007-57059029 TGCTCTCCTGGGTCATCTGGTGG + Intergenic
1158890594 18:61868363-61868385 TGCCCTGCAGGATCAGCTGGGGG - Intronic
1160747670 19:719580-719602 GGCGGTCCTGGTGCTGCTGGGGG - Intronic
1160776703 19:859820-859842 TGCCCACCTGGAGGGGCTGGAGG - Intronic
1160809000 19:1004944-1004966 TGACCTGCTGGAGCGGCTGGCGG + Exonic
1160911334 19:1475148-1475170 TGCCCGCCTGCTGCAGCCGCTGG + Exonic
1161358871 19:3834867-3834889 TACCCTGCCGGGGCAGCTGGGGG + Exonic
1161849433 19:6731012-6731034 CGTCCTCCTGGGGCAGCTGCAGG + Exonic
1161947136 19:7444436-7444458 CGACCTCCTGGTTCAGCAGGTGG + Exonic
1162053575 19:8050073-8050095 TCCACTCCTGCAGCAGCTGGGGG - Intronic
1162409914 19:10499496-10499518 TGACTTCCTGGTGCAGCAGCTGG - Exonic
1163292247 19:16386560-16386582 TGCCTTCCTGCTGTAGCTGGCGG - Intronic
1163391948 19:17036482-17036504 AGCCCTCTTGGTGCAGAGGGCGG - Intergenic
1166039344 19:40192289-40192311 GGATCTCCTGGGGCAGCTGGAGG - Exonic
1167090613 19:47341315-47341337 AGTGCTCCTGGTGCAGCCGGCGG - Exonic
1167499155 19:49835838-49835860 GGCCCTCCTGGAGCAGCTTCTGG + Exonic
1167972997 19:53200496-53200518 TTTCCTCCTGGTGCAGTCGGTGG + Intergenic
1168102855 19:54150177-54150199 TTCCCTGCTGGGGCAGCTGCAGG + Intronic
925749580 2:7075521-7075543 GGCCCTCATGATGCAACTGGTGG + Intergenic
926145328 2:10393736-10393758 TGCTCACCTGCTCCAGCTGGGGG + Intronic
927006917 2:18860935-18860957 TGCTCTGGTGGGGCAGCTGGTGG + Intergenic
927337558 2:21942744-21942766 GGACCTCATGGTTCAGCTGGAGG + Intergenic
927937155 2:27082507-27082529 TGTCCTCCTGCTGCTGCCGGCGG - Exonic
928388092 2:30886412-30886434 TGCCCACCTGGAGCAGCTGCTGG + Intergenic
932817699 2:74874898-74874920 GGGCCTCCTGCTGCAGCTGCAGG + Intronic
933355126 2:81200378-81200400 TCCCCTCCTTGTTCAGCTTGGGG + Intergenic
933817716 2:86081466-86081488 TCCGCTCCAGGTGCAGGTGGTGG - Intronic
934778202 2:96952153-96952175 TGCCCGCCCCTTGCAGCTGGAGG - Intronic
934859443 2:97751752-97751774 TGCACTCCTGGTGGAGGTGAAGG + Intergenic
935582233 2:104766620-104766642 TGCCTCCCTGCTGCAGGTGGAGG + Intergenic
935758497 2:106297081-106297103 TGTCCTCCTGGTGTAGATGTTGG + Intergenic
936073819 2:109389011-109389033 TGGGCTCCTGGTGTAGCTGGAGG - Intronic
936080033 2:109426593-109426615 TCTCCTCCTGGTGAAGATGGTGG + Intronic
946440861 2:219694014-219694036 TGCTCTCCTGGTCCTGATGGTGG + Intergenic
946941958 2:224778597-224778619 TGCCCTCTTGTGGCAGCTTGGGG + Intronic
947611692 2:231528684-231528706 GGACCTGCTGGTGCTGCTGGTGG - Exonic
947637628 2:231688134-231688156 TGCCTTGCAGGTGGAGCTGGGGG + Intergenic
947716934 2:232345563-232345585 TGCCCTGCTCGTGCTGCTGAGGG + Intergenic
947913948 2:233819919-233819941 TGCCATCCTGGTGCACCTGCCGG + Exonic
948008023 2:234626763-234626785 CACCCTCATGGTGCACCTGGTGG - Intergenic
948157968 2:235799936-235799958 TGCCCTCGGGGTGGAGGTGGGGG + Intronic
948503580 2:238411915-238411937 TGTCCTCCTAGTGCTGCTGCAGG - Intergenic
948790820 2:240375985-240376007 AGCCCTCCTGCTGCACCAGGGGG - Intergenic
1171293490 20:23995856-23995878 CTCCCTCCTGGAGCAGGTGGAGG - Intergenic
1172849286 20:37949159-37949181 TGTCCTCAAGGCGCAGCTGGTGG + Intergenic
1174282856 20:49452075-49452097 TGCCCTCCCGTTACAGCTGGGGG + Intronic
1174383253 20:50171125-50171147 TGCCCACCTTGTGAAACTGGGGG + Intergenic
1174443931 20:50577783-50577805 TGCCTGCCTGGAGCAGCTGGTGG + Intronic
1174475819 20:50795074-50795096 CGCCCTCCTGATGCTGCTCGTGG + Exonic
1174592644 20:51658439-51658461 TCCCATCCTGCTGCAGTTGGTGG - Intronic
1175222725 20:57426628-57426650 TGCCCTCCTGGGGGTGCTGTGGG - Intergenic
1176447468 21:6832076-6832098 TTCCTCCCTGCTGCAGCTGGAGG + Intergenic
1176825637 21:13697102-13697124 TTCCTCCCTGCTGCAGCTGGAGG + Intergenic
1177297204 21:19191163-19191185 TACCTTCCTAGAGCAGCTGGAGG - Intergenic
1178363408 21:31968587-31968609 TGCCCTGCAGGGGCACCTGGAGG + Intronic
1178514684 21:33236567-33236589 AGCCCTCCTGGTGCAGATGCTGG - Intronic
1178923285 21:36754323-36754345 CGCCCTCCTGGTGAACCTGGAGG + Exonic
1179491063 21:41741857-41741879 TGCCAGCCTGCTGCACCTGGCGG - Exonic
1179889918 21:44330293-44330315 TGCCATCCTGCTGCTGCTGCGGG - Exonic
1181045739 22:20213484-20213506 TGCCAGCCTGGTGCGCCTGGGGG + Intergenic
1181522508 22:23457718-23457740 TGCCCTCCAGGTGGGGGTGGGGG - Intergenic
1181639159 22:24187803-24187825 TGCGACGCTGGTGCAGCTGGTGG - Exonic
1182108046 22:27703357-27703379 GGCTCTCTTGGGGCAGCTGGGGG + Intergenic
1183186292 22:36293385-36293407 TTCCTTCCGGGAGCAGCTGGAGG - Exonic
1183316710 22:37141114-37141136 AGGCCTCCTGGTGCTGTTGGGGG + Intronic
1183369803 22:37426128-37426150 TGCCCTCCAGCCGCAGCTGCTGG + Intronic
1183472507 22:38017057-38017079 AGCCCTCCTGAGGCAGCTGTGGG + Intronic
1183522411 22:38303165-38303187 TGCTCTCGATGTGCAGCTGGGGG + Exonic
1183658403 22:39204327-39204349 TTCCCTCCTGGTGCTGCTGAAGG - Intergenic
1184041428 22:41946457-41946479 TGCTCTTCTGCAGCAGCTGGCGG - Exonic
1184648671 22:45909648-45909670 GGGCTTCCTGGTGCATCTGGCGG + Intergenic
949110157 3:250539-250561 TGTCCTCCTGGTACAGCAGTGGG + Intronic
953760736 3:45684820-45684842 TGTCTTCCAGGTGCAGCTGCCGG + Exonic
954138314 3:48592452-48592474 GGCCCTTCTAGGGCAGCTGGGGG + Exonic
954145859 3:48633996-48634018 TGGGCTCCCGGGGCAGCTGGAGG - Intronic
954322372 3:49840863-49840885 TGACTCCCTGGGGCAGCTGGAGG - Intronic
954745706 3:52786443-52786465 TGCCCACCTGGGGCAGCTGCAGG - Intronic
955082667 3:55672545-55672567 TGCCCTCCTCGTAGAGCTGATGG + Intronic
957755686 3:84483616-84483638 GGCCTTCCTGTTTCAGCTGGTGG - Intergenic
961326051 3:126110013-126110035 TGCCCACCTTGTGAAGCTGATGG - Exonic
962317436 3:134367592-134367614 TGCCCACCTGGCCCAGATGGAGG - Exonic
963615275 3:147528735-147528757 TGCCATGCTGCTGCAGCTGCTGG - Intergenic
966831819 3:184016958-184016980 TGTCTTCCTCGTGCAGCTTGAGG - Intronic
968449979 4:670947-670969 TGCCCTCCTGGTGCCGTCTGGGG - Intergenic
968541797 4:1171808-1171830 AGCCCTCCTGGTGGAGCAGGAGG + Intronic
968550743 4:1222442-1222464 GGCCCCCCTGGAGCTGCTGGGGG - Intronic
968607484 4:1542360-1542382 TCCACTACTGGAGCAGCTGGAGG + Intergenic
969222452 4:5770095-5770117 TCCTCTCCTGGTGGAGCTGAGGG + Intronic
969455809 4:7299055-7299077 TGCCCAGCTGGGGGAGCTGGGGG - Intronic
969484161 4:7462544-7462566 TCCCCTCCTGGTGCACCTGGAGG + Intronic
969494234 4:7516731-7516753 TCCCTTCCTGGTTCAGCTGCAGG - Intronic
969525928 4:7704091-7704113 TGCCCGGCGGGTCCAGCTGGAGG - Intronic
969646223 4:8431025-8431047 GGCCATCTTGGTGGAGCTGGAGG + Intronic
972166900 4:36297678-36297700 CTCCCTCCCTGTGCAGCTGGAGG + Intronic
976431992 4:84972892-84972914 TGCCCCACTGGAGCAGCAGGAGG - Intergenic
978749546 4:112231759-112231781 TGGCCTCCTTCGGCAGCTGGAGG + Exonic
983660697 4:170128043-170128065 GGCCCTCATGGTGCAGCAGCAGG + Intergenic
985084304 4:186297411-186297433 CGCCGTCCTGGAGCATCTGGTGG - Intergenic
985229336 4:187798526-187798548 TGCCCTGCAGCTGCTGCTGGAGG - Intergenic
985608978 5:876044-876066 TGCCCTTGGGGTGCTGCTGGCGG - Intronic
985931143 5:3058697-3058719 GCCCCTCCTGGGACAGCTGGTGG + Intergenic
985973226 5:3393523-3393545 GGCCCTCCTGGTGCTGCAAGGGG + Intergenic
989611701 5:43299989-43300011 TGCACTCCTGCTGAAGCTGCTGG + Intronic
991607668 5:68419912-68419934 AGCACTACTGGAGCAGCTGGAGG - Intergenic
992257484 5:74935503-74935525 AACCCTCCTGCTGAAGCTGGTGG + Intergenic
992494930 5:77282643-77282665 TGGACTCCTGCAGCAGCTGGAGG + Intronic
992564778 5:77986384-77986406 GACCCTCATGGTGCAGCTGCAGG + Intergenic
993187301 5:84636114-84636136 AGCCTCCCTGCTGCAGCTGGTGG + Intergenic
995544730 5:113218444-113218466 TGCCCTCCTGGTTGAGCGGGCGG - Intronic
997522852 5:134534452-134534474 TGCCATCCTGGTCCTGCTGGTGG + Intronic
1001515911 5:172355208-172355230 TGCCCAGCTGGTGCAGAGGGAGG + Intronic
1004688191 6:17968288-17968310 TGGACTCCAGGTGGAGCTGGAGG + Intronic
1005221611 6:23594523-23594545 TGCCCTCATTGTGCAGCAGCAGG + Intergenic
1006026427 6:31150113-31150135 TGCCCTCATGGTGCAGCTAAAGG - Exonic
1006150102 6:31982518-31982540 TGCCCTCCTGCTGCTTGTGGGGG + Intronic
1006156403 6:32015256-32015278 TGCCCTCCTGCTGCTTGTGGGGG + Intronic
1006175500 6:32118970-32118992 TGCCCTCCGGCGGCGGCTGGAGG - Exonic
1006449152 6:34096022-34096044 TCCCCTCCTGCTGCTGCTGTTGG - Intronic
1006516052 6:34546356-34546378 TGCCCTACTGGGACAGCAGGAGG + Intronic
1006573576 6:35025916-35025938 TGCCCTCTTGCTGCAGCTAAAGG - Intronic
1006639950 6:35484756-35484778 TGCCCTGCATGTGCAGCTTGGGG - Intronic
1006780852 6:36631475-36631497 TGCCCTCCTGGCTTGGCTGGGGG + Intergenic
1010379048 6:75205881-75205903 TGCACTCCAGGAGCACCTGGCGG + Exonic
1016783906 6:147989264-147989286 TGCCCCCCAGGTGCATGTGGAGG + Intergenic
1019110140 6:169702627-169702649 TGCCCTCGTGGTTCAGCCGCAGG - Exonic
1019306741 7:339051-339073 AGGCCTCCAGGTGCTGCTGGTGG + Intergenic
1019528836 7:1493772-1493794 TGACCACCTGGTGAAGCGGGCGG - Exonic
1019588825 7:1818849-1818871 TGCCCTCCAGGTGGGGGTGGGGG + Intronic
1019683519 7:2366769-2366791 TGCCCACCTGGCGCAGCCGTGGG + Intronic
1019740125 7:2668631-2668653 TGCTGTCCTGGACCAGCTGGAGG - Intergenic
1022965381 7:35467015-35467037 TGCCCTCCAAGTCCGGCTGGTGG + Intergenic
1023891431 7:44394758-44394780 TGCCCACATGGTGCTGATGGTGG - Intronic
1024225048 7:47320246-47320268 TTCCCTCCAGGTGCAGGTGAGGG - Intronic
1024982974 7:55173019-55173041 GGCCCTCCTCTTGCTGCTGGTGG + Exonic
1027502355 7:78969046-78969068 TGGCTTCCAGGTGCAGCTGCTGG - Intronic
1028852937 7:95556916-95556938 TGCCTTCCTGATGCAGCTGCAGG - Intergenic
1029123516 7:98282970-98282992 TTCCATCCTGGTCCAGCTCGTGG - Intronic
1029171001 7:98628891-98628913 TGCCTTCCTGCTGCAAGTGGAGG + Exonic
1030005307 7:105112650-105112672 TGCGGTCCTGGAGCAGGTGGTGG - Exonic
1031642987 7:124188767-124188789 TGCCCTCCTGCTAGTGCTGGAGG + Intergenic
1031926690 7:127645346-127645368 TTCGCTCCTGCTGCAGCTGTTGG - Intergenic
1033471242 7:141651543-141651565 TGCCCTCCACGTGCAGCTTGGGG - Exonic
1034783017 7:153899070-153899092 TGCCCTCCTGTAGCTGCTGCTGG + Intronic
1036345292 8:7957323-7957345 TGCCCTCCTGCAGCCTCTGGAGG - Intergenic
1036862424 8:12364335-12364357 TGCCCTCCTGCAGCCTCTGGAGG - Intergenic
1037897477 8:22667682-22667704 TGGCCTCCTGGAGCAAATGGTGG + Intronic
1037969827 8:23164129-23164151 GGCCCTCCTGGAGGTGCTGGGGG - Intergenic
1038455840 8:27671316-27671338 TGGCTTCCTGGTGGACCTGGAGG - Exonic
1038478330 8:27884481-27884503 AGGCCTCCTGGTGCAGCCAGAGG - Intronic
1038577485 8:28717433-28717455 TGCCGTCCCGGTGGTGCTGGGGG + Exonic
1039081061 8:33734408-33734430 TGCTCCCCTGTTGCAGCTAGTGG + Intergenic
1039406593 8:37318465-37318487 TGCCCTGCCTGTGCATCTGGGGG + Intergenic
1040015513 8:42696126-42696148 AGCCCTCCTGCAGGAGCTGGTGG + Intergenic
1040533746 8:48287910-48287932 TGCCCTCGTGGTGGATGTGGAGG + Intergenic
1041472071 8:58221920-58221942 TGCCCTCCTGATGGATCTGTAGG + Intergenic
1042847316 8:73181395-73181417 TGCCCTGCAGGAGCAGATGGTGG + Intergenic
1042947761 8:74172048-74172070 TGCCCTCCTGGGGTAACTTGGGG + Intergenic
1044726654 8:95199965-95199987 TGCACACTTGGAGCAGCTGGAGG + Intergenic
1047381865 8:124372053-124372075 CGCCGTCCTGGTGCTGCTGCGGG - Exonic
1047409948 8:124616071-124616093 TGCACTCTTGGTTCAGTTGGAGG - Intronic
1048899546 8:139024338-139024360 AGCCACCCTGGTGCAGGTGGAGG + Intergenic
1049573599 8:143380608-143380630 TGCCATCCTGGGGCAGGAGGAGG + Exonic
1049615830 8:143575519-143575541 CGCCCTCTTCCTGCAGCTGGTGG - Exonic
1049745834 8:144262910-144262932 TGAGCTCCTGGCGCAGCAGGTGG + Exonic
1050653595 9:7799631-7799653 GGCGCTCCGGGTGTAGCTGGGGG + Exonic
1052380553 9:27766457-27766479 TTCCCACCAGGTTCAGCTGGTGG + Intergenic
1053426361 9:38012729-38012751 TGCCCTCCGTGTGCCGCAGGTGG - Intronic
1053446843 9:38159241-38159263 TTCCTTCCTGGTGCATCTGATGG - Intergenic
1053749303 9:41236443-41236465 TGCTCTCCTTCTGCAGCAGGAGG - Intergenic
1054254744 9:62801294-62801316 TGCTCTCCTTCTGCAGCAGGAGG - Intergenic
1056058950 9:82862429-82862451 AGCCCTGCAGGTGCTGCTGGCGG + Intergenic
1057227010 9:93297777-93297799 CTCCCTCCTGGAGGAGCTGGCGG + Intronic
1058031636 9:100205265-100205287 TGCCATCCTGCTGCATCTGTTGG + Intronic
1059759834 9:117327345-117327367 TCCCCTCCAGGTGCTGCTGTAGG - Intronic
1060266132 9:122112386-122112408 TGCCCTCCCAGGGCAGCTGTGGG - Intergenic
1060530698 9:124345744-124345766 TGCCCCCGAGTTGCAGCTGGAGG - Intronic
1060932145 9:127495990-127496012 GGCCCTCCTGGAGGAGCTGTCGG + Exonic
1060936920 9:127521471-127521493 TGCATTCCTGGAGCAGCTGGGGG - Intronic
1060967124 9:127717571-127717593 TACCCTCCAGGGGCAGATGGTGG + Intronic
1061211096 9:129193927-129193949 TGCCTCCCAGGGGCAGCTGGGGG + Intergenic
1061952180 9:133942796-133942818 AGTCCTCCTGGTGCAGCTCTGGG + Intronic
1062167535 9:135115413-135115435 TGCCCTCCAGGTTCCCCTGGGGG + Intronic
1062254540 9:135614800-135614822 TGGGGTCCTGGTGCTGCTGGTGG + Intergenic
1062390615 9:136332255-136332277 CACCCACCTGGTGCAGCTGCAGG + Intronic
1062400285 9:136369773-136369795 GGCCATCCTGCTGCAGATGGAGG - Exonic
1062403090 9:136380976-136380998 TGCCCTTCTGATGCAGATGCAGG + Intronic
1062459220 9:136655897-136655919 TGCCCTACTGCTGGGGCTGGGGG - Intergenic
1062567987 9:137171705-137171727 CGCCCTCCTTGTGGTGCTGGCGG - Exonic
1062610886 9:137372916-137372938 TGCCCTCGTGGTGGAGGCGGTGG + Exonic
1062700691 9:137900212-137900234 TGCCCCCCTGGTCCAGGTGGAGG + Intronic
1203521723 Un_GL000213v1:52455-52477 TTCCTCCCTGCTGCAGCTGGAGG - Intergenic
1187270543 X:17776101-17776123 TGATCTCCTGGTGCAGCGGCGGG + Intergenic
1187319965 X:18229624-18229646 TGATCTCCTGGTGCAGCGGCGGG - Intergenic
1188005688 X:25014386-25014408 TGCCCTCATGGTGGAGCAGCGGG - Intronic
1195328515 X:103777343-103777365 TGCCCTCCTGGTTCTGCTGGAGG + Intronic
1196009362 X:110870742-110870764 TGCCCTCACAGGGCAGCTGGAGG + Intergenic
1196318981 X:114266461-114266483 TGGCCTCCTGATGCAGCAAGTGG - Intergenic
1196723900 X:118878814-118878836 TGCCCTCCTGGTGTCGCTGGTGG + Intergenic
1198891607 X:141403188-141403210 TGCCCTGCTTCTGCTGCTGGTGG - Intergenic
1199515950 X:148675671-148675693 TGCCTTCCTTGTGCATCTGCTGG + Intronic
1200948067 Y:8865666-8865688 TGCCCTCCTCTGGCACCTGGAGG + Intergenic