ID: 912828405

View in Genome Browser
Species Human (GRCh38)
Location 1:112927454-112927476
Sequence GGTCCAAATGAACAAGTTAA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
912828403_912828405 10 Left 912828403 1:112927421-112927443 CCATATCTCAAGACGTATTAGTG 0: 1
1: 0
2: 1
3: 1
4: 51
Right 912828405 1:112927454-112927476 GGTCCAAATGAACAAGTTAAAGG No data
912828402_912828405 14 Left 912828402 1:112927417-112927439 CCAACCATATCTCAAGACGTATT No data
Right 912828405 1:112927454-112927476 GGTCCAAATGAACAAGTTAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
912828405 Original CRISPR GGTCCAAATGAACAAGTTAA AGG Intronic
No off target data available for this crispr