ID: 912830724

View in Genome Browser
Species Human (GRCh38)
Location 1:112951223-112951245
Sequence TATTACAAATGAAAAGTGGG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
912830717_912830724 16 Left 912830717 1:112951184-112951206 CCTTCCTGCAAAGAGAAAAATAT No data
Right 912830724 1:112951223-112951245 TATTACAAATGAAAAGTGGGGGG No data
912830715_912830724 28 Left 912830715 1:112951172-112951194 CCTATAACACTCCCTTCCTGCAA 0: 1
1: 0
2: 1
3: 15
4: 197
Right 912830724 1:112951223-112951245 TATTACAAATGAAAAGTGGGGGG No data
912830716_912830724 17 Left 912830716 1:112951183-112951205 CCCTTCCTGCAAAGAGAAAAATA 0: 1
1: 0
2: 3
3: 75
4: 797
Right 912830724 1:112951223-112951245 TATTACAAATGAAAAGTGGGGGG No data
912830718_912830724 12 Left 912830718 1:112951188-112951210 CCTGCAAAGAGAAAAATATATAA 0: 1
1: 0
2: 6
3: 86
4: 1188
Right 912830724 1:112951223-112951245 TATTACAAATGAAAAGTGGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
912830724 Original CRISPR TATTACAAATGAAAAGTGGG GGG Intronic
No off target data available for this crispr