ID: 912831328

View in Genome Browser
Species Human (GRCh38)
Location 1:112956351-112956373
Sequence TCTAGCTCGCCCGCGCGCGC CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
912831321_912831328 12 Left 912831321 1:112956316-112956338 CCCGCGCCTCCACACGCTTTCAG 0: 1
1: 0
2: 0
3: 13
4: 115
Right 912831328 1:112956351-112956373 TCTAGCTCGCCCGCGCGCGCCGG No data
912831320_912831328 23 Left 912831320 1:112956305-112956327 CCGAACTGCAGCCCGCGCCTCCA 0: 1
1: 0
2: 0
3: 11
4: 237
Right 912831328 1:112956351-112956373 TCTAGCTCGCCCGCGCGCGCCGG No data
912831322_912831328 11 Left 912831322 1:112956317-112956339 CCGCGCCTCCACACGCTTTCAGC 0: 1
1: 0
2: 0
3: 11
4: 118
Right 912831328 1:112956351-112956373 TCTAGCTCGCCCGCGCGCGCCGG No data
912831324_912831328 3 Left 912831324 1:112956325-112956347 CCACACGCTTTCAGCCGCGCGCG 0: 1
1: 0
2: 0
3: 2
4: 37
Right 912831328 1:112956351-112956373 TCTAGCTCGCCCGCGCGCGCCGG No data
912831323_912831328 6 Left 912831323 1:112956322-112956344 CCTCCACACGCTTTCAGCCGCGC 0: 1
1: 0
2: 0
3: 3
4: 42
Right 912831328 1:112956351-112956373 TCTAGCTCGCCCGCGCGCGCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
912831328 Original CRISPR TCTAGCTCGCCCGCGCGCGC CGG Intronic
No off target data available for this crispr