ID: 912843149

View in Genome Browser
Species Human (GRCh38)
Location 1:113057140-113057162
Sequence CAGAACAAGAAGAACCAGGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
912843149_912843154 26 Left 912843149 1:113057140-113057162 CCTGCCTGGTTCTTCTTGTTCTG No data
Right 912843154 1:113057189-113057211 AGCAGCAGGTTCCCAGTGGCTGG No data
912843149_912843151 12 Left 912843149 1:113057140-113057162 CCTGCCTGGTTCTTCTTGTTCTG No data
Right 912843151 1:113057175-113057197 TTACCAGCTGCTTAAGCAGCAGG No data
912843149_912843153 22 Left 912843149 1:113057140-113057162 CCTGCCTGGTTCTTCTTGTTCTG No data
Right 912843153 1:113057185-113057207 CTTAAGCAGCAGGTTCCCAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
912843149 Original CRISPR CAGAACAAGAAGAACCAGGC AGG (reversed) Intergenic
No off target data available for this crispr