ID: 912848241

View in Genome Browser
Species Human (GRCh38)
Location 1:113096814-113096836
Sequence CTTATTATCTGATATGTGCC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 362
Summary {0: 1, 1: 0, 2: 2, 3: 32, 4: 327}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
912848239_912848241 29 Left 912848239 1:113096762-113096784 CCAGTTCACTGTTACTGGTTTGC 0: 1
1: 0
2: 0
3: 10
4: 113
Right 912848241 1:113096814-113096836 CTTATTATCTGATATGTGCCAGG 0: 1
1: 0
2: 2
3: 32
4: 327

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
912848241 Original CRISPR CTTATTATCTGATATGTGCC AGG Intronic
903769691 1:25756101-25756123 CTAAGTTTCTGATCTGTGCCAGG - Intronic
904845795 1:33414106-33414128 TTTAGTATCTTATATATGCCAGG - Intronic
905937003 1:41832671-41832693 CTAAATATCTACTATGTGCCAGG - Intronic
906852946 1:49271428-49271450 CTTATTATCAGATTTTAGCCAGG - Intronic
906975829 1:50571839-50571861 CTTAGTATCTGCTCTCTGCCTGG - Intronic
908186320 1:61656175-61656197 CTGAATATCTATTATGTGCCAGG + Intergenic
908426344 1:64011344-64011366 CTTAGTACCTGCTCTGTGCCAGG + Intronic
908855594 1:68423399-68423421 CTGATTATCTACTGTGTGCCAGG - Intergenic
910809908 1:91225527-91225549 CTTATTATCAGATTTTAGCCAGG - Intergenic
910890659 1:92016325-92016347 TTGATTATCTGCAATGTGCCAGG - Intergenic
911978705 1:104537939-104537961 CTAATTATCTTCTATATGCCAGG + Intergenic
912469738 1:109898311-109898333 CTTAATATTTACTATGTGCCTGG - Intergenic
912848241 1:113096814-113096836 CTTATTATCTGATATGTGCCAGG + Intronic
914416553 1:147488676-147488698 CTCATTAAGTGATATGTACCAGG - Intergenic
914897940 1:151693609-151693631 CTGATTATCTCATGTGAGCCAGG + Exonic
915307647 1:154989849-154989871 TTGAGTATATGATATGTGCCTGG + Intronic
915612102 1:157002148-157002170 ATTATCATGTGATTTGTGCCTGG - Intronic
916967641 1:169967901-169967923 ATTATTTTCTGATATGGGGCTGG - Intronic
918589169 1:186221784-186221806 CAGATTTTCTGATATGTTCCTGG - Intergenic
919227315 1:194722409-194722431 TTTAATATCTGATAGTTGCCAGG - Intergenic
919480042 1:198076994-198077016 TTTATTATCTCCTATGTGCCTGG - Intergenic
920073034 1:203316861-203316883 CTTCTTATCTGATATGCTCTAGG - Intergenic
920404521 1:205699066-205699088 CTGAGGATCTGATGTGTGCCCGG + Intergenic
920438357 1:205962601-205962623 TTTATTGTCTACTATGTGCCTGG + Intergenic
920938502 1:210458338-210458360 CTTGTTTTGTGTTATGTGCCAGG + Intronic
922014870 1:221635130-221635152 CTAAGTATGTGTTATGTGCCAGG + Intergenic
923953758 1:238991430-238991452 TTAATTATGTGTTATGTGCCAGG + Intergenic
924019658 1:239767665-239767687 CTTAGTATTTATTATGTGCCAGG + Intronic
924500566 1:244634412-244634434 TTTATTATTTGTTATGTGCTTGG - Intronic
1062776618 10:155014-155036 CTTAGTATATGATATGCTCCTGG + Intronic
1063068603 10:2636204-2636226 TTTATTATCTGTTATATGCCAGG - Intergenic
1063399408 10:5727886-5727908 TTTATTATTTTATAGGTGCCTGG - Intronic
1063606955 10:7531123-7531145 CTTAGTATCTACTCTGTGCCGGG + Intergenic
1063910066 10:10820466-10820488 TTGAGTATCTAATATGTGCCAGG + Intergenic
1064919653 10:20502675-20502697 TTTATTATCTACTATGTGCTAGG - Intergenic
1064991061 10:21257470-21257492 CTTACTAGCTATTATGTGCCAGG - Intergenic
1066183122 10:32982422-32982444 CTGAATATCTATTATGTGCCAGG - Intronic
1069391467 10:67940374-67940396 GTGATTATCTGATATTTGCAAGG + Intronic
1069628456 10:69882498-69882520 CCTATTATGTGACAGGTGCCTGG - Intronic
1070727304 10:78801270-78801292 CTGATTATCTGCTATGGGGCAGG + Intergenic
1072986595 10:100146230-100146252 TTGAGTACCTGATATGTGCCAGG - Intergenic
1073271299 10:102266393-102266415 TTGACTATCTGGTATGTGCCAGG + Intronic
1073546791 10:104355626-104355648 CTGATTGTTTGCTATGTGCCAGG - Intronic
1073886930 10:108050136-108050158 CTTATTCACTGATGTGTCCCTGG + Intergenic
1074605319 10:114957990-114958012 ATTATTATCTGTTATTTACCAGG + Intronic
1075203421 10:120425631-120425653 CTGAGTACCTAATATGTGCCAGG - Intergenic
1075209317 10:120477760-120477782 CTGAGTATCTACTATGTGCCAGG - Intronic
1075224436 10:120613652-120613674 CTTGTTATATCATGTGTGCCAGG + Intergenic
1075701847 10:124474995-124475017 TTTAGTATTTGAAATGTGCCAGG + Intronic
1078201021 11:9183337-9183359 TTTATTATGTACTATGTGCCTGG - Intronic
1079495474 11:21038541-21038563 CTTATTTTCTGATATTTGCTTGG + Intronic
1080127573 11:28755027-28755049 CATATTATTTGTTATGTGTCAGG - Intergenic
1080731342 11:34957775-34957797 CTGAATATCTGCTATGTTCCAGG + Intronic
1081329879 11:41789789-41789811 CTTATTATCAGATTTTAGCCAGG - Intergenic
1081541666 11:44039059-44039081 CTTGGTATCTAATAGGTGCCCGG + Intergenic
1086221954 11:84456405-84456427 TTAATTATTTGATATGTGCAAGG + Intronic
1086320037 11:85636455-85636477 TTTATTATCTGTTATATACCAGG - Exonic
1086434456 11:86767599-86767621 CTGATTATCTACTATGTGCCAGG - Intergenic
1086494949 11:87393300-87393322 TTTGTTATCTTATATGAGCCTGG - Intergenic
1086538635 11:87881186-87881208 TTTAGTATCTTCTATGTGCCAGG - Intergenic
1087773776 11:102239299-102239321 TTGAGTATCTAATATGTGCCAGG + Intergenic
1088568507 11:111198072-111198094 CTGAGTATCTGCCATGTGCCAGG - Intergenic
1089160244 11:116431869-116431891 CTGAGTATCTCCTATGTGCCAGG + Intergenic
1090149555 11:124368018-124368040 CTGATTATTTGTCATGTGCCAGG - Intergenic
1090200106 11:124847910-124847932 CTGAATATCTTCTATGTGCCAGG + Intergenic
1091897148 12:4114710-4114732 CGTATTAGCTCCTATGTGCCAGG + Intergenic
1093528203 12:20129752-20129774 TTAAGTATCTGTTATGTGCCAGG - Intergenic
1094026193 12:25961708-25961730 TTTATTGGCTGAAATGTGCCAGG - Intronic
1094153225 12:27309827-27309849 TTGATTATCTGATATGTGACAGG - Intronic
1094237819 12:28188816-28188838 ATTAATATTTGCTATGTGCCTGG - Intronic
1095281514 12:40356693-40356715 CTTATTATCTGATGAGAGACAGG + Intronic
1096167815 12:49438832-49438854 CTGTCTATCTGCTATGTGCCCGG + Intronic
1096678222 12:53237187-53237209 CTGAGTATCTGCTATGTGCCAGG + Intergenic
1098949959 12:76629923-76629945 AGTATTATCTGCTATGTGCTAGG + Intergenic
1099176756 12:79430954-79430976 CTGAGTGTCTGTTATGTGCCAGG - Intronic
1100930982 12:99609251-99609273 CTTATTATCAGATTTCAGCCAGG + Intronic
1101193211 12:102355964-102355986 TTTATTATCTGACATGTGCCTGG + Intergenic
1101509097 12:105376687-105376709 CTGAGTATCTGTTATATGCCTGG + Intronic
1101563040 12:105877910-105877932 CTTATTCTCTGCCATGTCCCTGG - Intergenic
1102053260 12:109878758-109878780 CTGAGCATCTGCTATGTGCCAGG + Intronic
1102100037 12:110271190-110271212 CTGAGCATCTGCTATGTGCCTGG + Intergenic
1104640566 12:130464421-130464443 CTGAATACCTGCTATGTGCCAGG + Intronic
1105982200 13:25529294-25529316 CTCACTATCTGCTATGTGCTAGG + Intronic
1106201153 13:27538439-27538461 CTTAGCATCTACTATGTGCCAGG - Intergenic
1106681750 13:32015667-32015689 TTTATAATCTGTTATGTACCAGG + Intergenic
1107311876 13:39087196-39087218 CTTATTACCTGAGATTTGACAGG + Intergenic
1108151779 13:47543445-47543467 CTGAGTATCTGAGATGTGCTTGG - Intergenic
1108719927 13:53120690-53120712 CTTATTATTTACTATGTGCCAGG + Intergenic
1109565638 13:64111876-64111898 CTTATTTTCTGAGTTGTCCCAGG + Intergenic
1109724168 13:66317183-66317205 ATAATTATCTGCAATGTGCCAGG - Intronic
1109906584 13:68849903-68849925 CTTATTTTCTGATATTTAACTGG - Intergenic
1110481624 13:75984463-75984485 TTTATTATCTACTATATGCCAGG + Intergenic
1110499916 13:76215035-76215057 CTTATTTATTGATATGTGCCAGG + Intergenic
1110933706 13:81256011-81256033 CTAATTACCTGCTATGTGCCAGG - Intergenic
1111975551 13:94963306-94963328 GTTACTATCTGCTGTGTGCCAGG + Intergenic
1114841441 14:26267329-26267351 CTGAGTGTCTGATAGGTGCCAGG + Intergenic
1114954646 14:27802821-27802843 ATTATTATGTGATATGTGTAAGG - Intergenic
1115779330 14:36751984-36752006 TTGAGTATCTGATATGTGCCAGG + Intronic
1115934368 14:38535142-38535164 TTTATTATCTACTATGTGCTAGG + Intergenic
1117623386 14:57610794-57610816 CTGAGTATCTCCTATGTGCCAGG + Intronic
1117696976 14:58375580-58375602 TTTAGTATCTTCTATGTGCCAGG + Intergenic
1118126859 14:62915010-62915032 CTTATTGTCTGTTCTGTGCCAGG - Intronic
1118456528 14:65949849-65949871 CTAAGCATCTGCTATGTGCCAGG - Intergenic
1118976519 14:70682333-70682355 CTGAGAATCTGCTATGTGCCAGG - Intergenic
1119050199 14:71359552-71359574 TTTATTATCTACTATGTGGCAGG - Intronic
1119624806 14:76163857-76163879 CTGAATGTCTGATATGTGCCAGG + Intronic
1120396346 14:83971639-83971661 CTGAGTATCTAAAATGTGCCAGG - Intergenic
1120792193 14:88595119-88595141 CTTAATATATGATATGTTCTAGG + Intronic
1122714925 14:103690450-103690472 CTGAGTATCTGCCATGTGCCAGG + Intergenic
1124409722 15:29427028-29427050 CTTATTATCTTATGGGTGCTTGG + Intronic
1126142001 15:45446557-45446579 CTTATCACCTGGTGTGTGCCTGG - Intronic
1126266847 15:46764977-46764999 CTTATTCTCTGATAGGTCTCCGG + Intergenic
1126446182 15:48747338-48747360 TTTATTATCTGGTATGTGGTGGG + Intronic
1126618406 15:50611128-50611150 GTTGTTATCTGATATGTGGATGG - Exonic
1126652336 15:50937430-50937452 TTGAATATCTGCTATGTGCCAGG + Intronic
1127066359 15:55243725-55243747 CTTATTATATGCTAGGTGCCAGG + Intronic
1127330294 15:57932446-57932468 CTGATTATCTGAAGTCTGCCAGG + Intergenic
1127700819 15:61498734-61498756 CTAAGTATCTATTATGTGCCAGG - Intergenic
1127744067 15:61946202-61946224 TTTATTATCTGTCATGTACCAGG - Intronic
1127747801 15:61998454-61998476 TTTAGTAACTGCTATGTGCCAGG + Intronic
1129201119 15:74000842-74000864 CTGAGTATTTAATATGTGCCAGG - Intronic
1129429350 15:75487522-75487544 CTGAGTGTCTGATATGTGGCAGG + Intronic
1131090185 15:89618631-89618653 CTGATCACCTGCTATGTGCCAGG - Intronic
1131090754 15:89623187-89623209 CTGATCACCTGCTATGTGCCAGG - Intronic
1132170774 15:99651969-99651991 CTTTTTATGTCATATGTGTCAGG + Intronic
1132419651 15:101654189-101654211 CTTATTTTCTAATATGTCTCAGG - Exonic
1133826065 16:9279298-9279320 CTGAGTATCTACTATGTGCCGGG - Intergenic
1133918724 16:10132770-10132792 CTTATAATCTGTTAAGTGCCAGG - Intronic
1135502156 16:23005700-23005722 CTGATTTTCTGTTATGTGTCAGG + Intergenic
1137503160 16:49026837-49026859 CTTAGCATCTTTTATGTGCCAGG - Intergenic
1137758764 16:50923780-50923802 TTGAGTATCTGCTATGTGCCAGG - Intergenic
1138126617 16:54443960-54443982 CTCATTAGGTGATATGTCCCTGG + Intergenic
1141190500 16:81821263-81821285 TTTAGCATCTGCTATGTGCCAGG - Intronic
1143143525 17:4757393-4757415 TTTACTAAATGATATGTGCCAGG - Intergenic
1146246708 17:31291211-31291233 CTTAGTGTTTGATATGTTCCAGG + Intronic
1146481530 17:33208783-33208805 CTGAGCATCTGCTATGTGCCAGG - Intronic
1147924220 17:43936684-43936706 CTGAGTATCTGCTAAGTGCCAGG + Intergenic
1148656781 17:49290177-49290199 CTTCTTAACTGATTTCTGCCTGG - Intronic
1148666805 17:49381043-49381065 CTGAATAACTGCTATGTGCCAGG - Intronic
1148812159 17:50300290-50300312 CTGAGCATCTGCTATGTGCCAGG - Intergenic
1150502612 17:65665529-65665551 CTTTTCTTCTGATATGAGCCTGG + Intronic
1151242438 17:72768628-72768650 CACATTATCTCATATGTGACTGG + Intronic
1151625628 17:75273698-75273720 CTTAAGATCTGTGATGTGCCAGG - Intronic
1151773457 17:76180502-76180524 CTGAGTATCTACTATGTGCCAGG + Intronic
1154074828 18:11189507-11189529 CTGATCACCTGCTATGTGCCAGG + Intergenic
1155375219 18:25150055-25150077 GTTATTATCTAATATAAGCCAGG - Intronic
1156093667 18:33502806-33502828 CTTATTCTCTGAAATGTTCTAGG + Intergenic
1160435515 18:78849361-78849383 CTGATGATCTGTTAGGTGCCTGG - Intergenic
1161876353 19:6914065-6914087 CTGATTAGCTGCTATGTGCTGGG + Intronic
1161881173 19:6954053-6954075 TTTATTGTCCGCTATGTGCCAGG - Intergenic
1163245430 19:16090939-16090961 CCTAGTATCAGATATATGCCAGG - Intronic
1164695657 19:30241716-30241738 CTGAGTGTCTGCTATGTGCCAGG + Intronic
1165928225 19:39340748-39340770 TTGACTATCTAATATGTGCCAGG - Intronic
925427845 2:3765651-3765673 CTGAGCATCTGCTATGTGCCAGG + Intronic
930118902 2:47743787-47743809 CTTATTATCAGATTTCAGCCAGG - Intronic
930777258 2:55185606-55185628 TTGATTATCTAATATGTGCTGGG - Intronic
930842970 2:55868267-55868289 TTTAGCATCTGCTATGTGCCAGG + Intronic
930886695 2:56334287-56334309 GTTATTATCTGCTATGTGCCAGG - Intronic
931887614 2:66634017-66634039 TTTATTATGTGCTGTGTGCCAGG + Intergenic
933327263 2:80853736-80853758 CTTATTAACTGATATGTGAATGG + Intergenic
933946751 2:87293365-87293387 CTTTTTAGCTGAAGTGTGCCAGG - Intergenic
935124126 2:100207898-100207920 CTTCTTATCAGACATGTGCGTGG - Intergenic
935212961 2:100954144-100954166 CTAATTATCTGGTGTCTGCCCGG + Intronic
935818773 2:106872946-106872968 TTAATTAACTGACATGTGCCAGG + Intronic
936854490 2:116940168-116940190 TTTAGTATCTACTATGTGCCAGG + Intergenic
937049357 2:118875794-118875816 CTTATTCTCTGCTGTGTCCCAGG + Intergenic
937152634 2:119696457-119696479 TTGAACATCTGATATGTGCCAGG + Intergenic
938646745 2:133339078-133339100 CTTATAATCAGTTATGTGCAGGG + Intronic
939715297 2:145576442-145576464 CTTATTCAATGCTATGTGCCAGG - Intergenic
940459273 2:153941704-153941726 ATTATTATTTTATAAGTGCCAGG + Intronic
940492244 2:154377675-154377697 TTTATTATCTAATATGTCCCAGG + Intronic
941103761 2:161328026-161328048 TTTATTGTCTGTTATTTGCCGGG - Intronic
941577273 2:167248681-167248703 CTTATTATCTTTTATATGCTTGG - Exonic
941585062 2:167348138-167348160 CTGAATATGTGTTATGTGCCAGG - Intergenic
942098360 2:172555298-172555320 TTTATTATCTGGTATGTCCCCGG + Intergenic
942105106 2:172625804-172625826 CATATTTTTTGCTATGTGCCAGG - Intergenic
942473678 2:176291394-176291416 CTGATTACCTGCTATGTGCTAGG + Intronic
942895298 2:181046088-181046110 CTGATTATCTACCATGTGCCAGG - Intronic
943059118 2:183019683-183019705 CTTGTTATCTAATGTGTGCCAGG - Intronic
943615827 2:190090956-190090978 GTTATTACCTATTATGTGCCAGG - Intronic
944858979 2:203796708-203796730 TTTAGTATCTGTTAGGTGCCAGG - Intergenic
945704481 2:213212610-213212632 CTTATTACCTGATTTTAGCCAGG + Intergenic
945872537 2:215243659-215243681 CTTATTGTCTGTTATGTAGCAGG + Intergenic
949078527 2:242077585-242077607 TTTAGTGTCTGCTATGTGCCTGG + Intergenic
1169060516 20:2657510-2657532 CTTATTATCAGACGTGTGTCCGG + Intronic
1169817406 20:9672327-9672349 CTGAGTATCTAGTATGTGCCAGG - Intronic
1169826732 20:9776964-9776986 CTAATTATATGAGATGTGCCAGG + Intronic
1170171675 20:13420692-13420714 CTTAGAATCTAAGATGTGCCAGG + Intronic
1170502227 20:16986606-16986628 CAAAGCATCTGATATGTGCCTGG - Intergenic
1171356717 20:24551891-24551913 CTTAGTGTCTGATATGTTCTGGG + Intronic
1172302143 20:33857799-33857821 CTTCGTACCTGATCTGTGCCAGG - Intergenic
1172880564 20:38197043-38197065 CTGAGTACCTGCTATGTGCCAGG + Intergenic
1172942390 20:38663499-38663521 CTGGTTATCTGCCATGTGCCAGG + Intergenic
1173659460 20:44723289-44723311 CGTAGCATCTGCTATGTGCCAGG - Intronic
1173670062 20:44792739-44792761 TTTATTATTTCATATATGCCAGG - Intronic
1174514006 20:51077220-51077242 TTTAGGATCTGTTATGTGCCCGG + Intergenic
1176865759 21:14054158-14054180 CTTTTTTTCTTATATCTGCCAGG + Intergenic
1177082543 21:16658472-16658494 TTTATTCTCTGGTATGTGCCAGG + Intergenic
1182403867 22:30107030-30107052 CATAGTATTTGTTATGTGCCAGG - Intronic
1183809144 22:40239221-40239243 TTTATTGTCTAATATGAGCCAGG - Intronic
1184398947 22:44262444-44262466 CTGATTATCTCTTCTGTGCCGGG + Intronic
949615782 3:5752463-5752485 CTCATCATCAAATATGTGCCTGG - Intergenic
950076364 3:10189983-10190005 TTTAGCACCTGATATGTGCCAGG + Intronic
951008207 3:17644501-17644523 ATTAATATTTGTTATGTGCCAGG - Intronic
951068580 3:18297228-18297250 CTTATTATCAGAAATCTGACAGG + Intronic
951572375 3:24078220-24078242 CTGAATATCTCATAGGTGCCAGG - Intergenic
951697299 3:25458964-25458986 TTGATTATCTGCCATGTGCCAGG + Intronic
952277526 3:31891920-31891942 TTTACTATCTGCTATGAGCCAGG + Intronic
955461062 3:59183589-59183611 TGTATTATCAGATATTTGCCAGG + Intergenic
957785097 3:84872066-84872088 CATATTAGCTGCTATGTTCCGGG - Intergenic
959205238 3:103298462-103298484 CTTAGTATCTAGTAAGTGCCAGG + Intergenic
959285843 3:104409782-104409804 CTGAATATCTTATATGTTCCAGG + Intergenic
959423396 3:106155327-106155349 TTTATTATCTTCTATGTACCAGG + Intergenic
960059617 3:113307619-113307641 CTTAGCATCAGATAAGTGCCTGG + Intronic
960809361 3:121613320-121613342 CTTATTATCTGATATGAACAAGG - Intronic
961209534 3:125115072-125115094 GTTAGCATCTGCTATGTGCCAGG + Intronic
961613869 3:128163448-128163470 ATTATTATCTGCTGTATGCCAGG - Intronic
962219211 3:133549610-133549632 GTTAGTAACTGCTATGTGCCAGG + Intergenic
962629185 3:137258724-137258746 CTGAATATCTATTATGTGCCAGG - Intergenic
963355284 3:144203608-144203630 TTTATTATCTGATATGTATATGG + Intergenic
963700917 3:148625708-148625730 CTGAATACCTGCTATGTGCCAGG - Intergenic
964527667 3:157632247-157632269 TTTATGATTTGGTATGTGCCTGG + Intronic
965211849 3:165800775-165800797 TTTATTGCCTGACATGTGCCAGG + Intronic
967679936 3:192349901-192349923 CTGAATACCTAATATGTGCCAGG + Intronic
967701641 3:192599511-192599533 TTTATTATCTTATAGATGCCAGG - Intronic
968322566 3:197783495-197783517 TTTAATATCTGATATTTTCCTGG + Exonic
969038946 4:4278676-4278698 CTGAGTGTCTGATCTGTGCCAGG - Intronic
970373890 4:15436578-15436600 CTTTTTAGCTGCTATGTGTCAGG - Intronic
970766986 4:19561819-19561841 CTCATTGTCTGTTATGTGTCAGG + Intergenic
970820867 4:20211537-20211559 CTTATTTTCTGCTTTGTCCCAGG + Intergenic
972258868 4:37387957-37387979 TTTATTAAATGATTTGTGCCAGG + Intronic
973969571 4:56198596-56198618 TTTATTATCTACTGTGTGCCAGG + Intronic
973977803 4:56280597-56280619 CTGAATACCTGCTATGTGCCGGG - Intronic
974239385 4:59225994-59226016 TTTACTGTCTGATATGTACCAGG + Intergenic
974350706 4:60742337-60742359 CTCTTTATCTGAAATCTGCCTGG + Intergenic
974408632 4:61509421-61509443 ATTAAGATGTGATATGTGCCAGG - Intronic
975855558 4:78620850-78620872 TTGATAATCTAATATGTGCCAGG - Intergenic
977226600 4:94399185-94399207 TTTATTATGTGCCATGTGCCAGG - Intergenic
977276526 4:94983905-94983927 CTTAGTACCTGTTATGGGCCTGG - Intronic
977351881 4:95898616-95898638 CTTATTTACTGATATATCCCAGG - Intergenic
977499893 4:97824999-97825021 CTTATTACCTGATTTTAGCCAGG - Intronic
977788233 4:101065969-101065991 CTGAGTATCTGATATATGCCAGG + Intronic
979392725 4:120145461-120145483 CTTACCATTTAATATGTGCCCGG - Intergenic
979507079 4:121510546-121510568 TTAAGTATCTGCTATGTGCCAGG - Intergenic
981201072 4:141980006-141980028 CTTATTACCTGATTTTAGCCAGG - Intergenic
983591082 4:169412119-169412141 TTAAATATCTGCTATGTGCCAGG - Intronic
986373270 5:7102657-7102679 CTTGTTATTTGCTATGTGCCAGG - Intergenic
987023251 5:13896649-13896671 TTTATTATCTCCTATGTGCCAGG - Intronic
988450211 5:31334509-31334531 CTTATTGACTGATATATGCAGGG - Intergenic
988854846 5:35218227-35218249 AATATTATATGATATGTGTCAGG - Intronic
989196574 5:38722521-38722543 CTGATTATCTACTATGTGCTAGG - Intergenic
989271366 5:39537382-39537404 CTTATTATCTGGAATGTGCAAGG - Intergenic
990519598 5:56566021-56566043 TTTATTATTTGCTATGTGTCAGG + Intronic
991011423 5:61886888-61886910 CTAATTATTAGATATGTGCCAGG + Intergenic
992012192 5:72540157-72540179 CTTAATACCTGCTATGTGCTAGG - Intergenic
992190502 5:74286917-74286939 CTTCTTTTCTGACATATGCCAGG + Intergenic
994619188 5:102142670-102142692 TTTAATATCTAATATATGCCTGG + Intergenic
995399861 5:111728750-111728772 CTTATCATCTGGTAGGTTCCAGG + Intronic
995817003 5:116181876-116181898 CTAAACATCTAATATGTGCCAGG + Intronic
997379524 5:133425747-133425769 CTTATTCTCTGCTGTGTCCCAGG - Intronic
997602287 5:135148912-135148934 ATGAGTATCTGATGTGTGCCAGG + Intronic
998800440 5:145863911-145863933 CTGATTACCTGTTATATGCCAGG + Intronic
999927966 5:156399851-156399873 CTTATATTCTGCTATGTTCCAGG - Intronic
1001322876 5:170697394-170697416 CTAAGTATCTAATATGTGCAAGG - Intronic
1003967772 6:11269717-11269739 CTTATTAATTGAGTTGTGCCAGG + Intronic
1005915331 6:30345908-30345930 CTTATTTTCTAAAATGTGTCAGG + Intronic
1007846550 6:44762683-44762705 CTTATTATCAGATTTTAGCCAGG + Intergenic
1007876962 6:45114209-45114231 CTGATTGCCTGGTATGTGCCAGG + Intronic
1009482213 6:64173008-64173030 CTGAATATCTGGTATGTCCCAGG + Intronic
1010169474 6:72958013-72958035 CTTATGAACTGATGTGTCCCTGG + Intronic
1011142430 6:84173619-84173641 ATTATTATCTCCTATTTGCCAGG + Intronic
1011972446 6:93244374-93244396 ATTATTTTCTGGTATATGCCAGG - Intronic
1011989048 6:93489505-93489527 GTTATTCTGTGCTATGTGCCAGG - Intergenic
1012341615 6:98132294-98132316 CTGAGTATCTATTATGTGCCAGG + Intergenic
1013536883 6:111071085-111071107 CTTAATTTGTGATTTGTGCCAGG + Intergenic
1014341658 6:120215748-120215770 CTTATTATCTGCTAGTAGCCAGG + Intergenic
1014641274 6:123913934-123913956 CTTAATATTTACTATGTGCCTGG + Intronic
1014685493 6:124494246-124494268 TTTAGCATCTGATATGTGTCAGG - Intronic
1016094420 6:140018721-140018743 TTTATTACCTAATATGTGCTAGG + Intergenic
1016439130 6:144065220-144065242 CTGATTGTCAGTTATGTGCCAGG + Intergenic
1017538404 6:155373276-155373298 CTGAGTATCTATTATGTGCCAGG + Intergenic
1018002253 6:159589650-159589672 CTAATTACCTGTTCTGTGCCAGG - Intergenic
1018248826 6:161847751-161847773 CTGAATACCTGTTATGTGCCAGG + Intronic
1019133657 6:169895053-169895075 CTGATCATCTGCTATGTGCTGGG + Intergenic
1020426359 7:8070596-8070618 CTGAATATCTGCCATGTGCCAGG + Intronic
1020570473 7:9854212-9854234 CTTACTCTCTGATCTGTACCAGG - Intergenic
1020647788 7:10836286-10836308 TTTATTAACTGATATTTCCCTGG - Intergenic
1020827282 7:13045294-13045316 TTAATTATCCAATATGTGCCAGG + Intergenic
1022785092 7:33630856-33630878 TTTATTGTCTACTATGTGCCAGG + Intergenic
1024348129 7:48334254-48334276 CTGAGTATTTGCTATGTGCCAGG + Intronic
1026640980 7:72125361-72125383 CTGATTGTCTCCTATGTGCCAGG + Intronic
1028155522 7:87424789-87424811 CTGAGAATCTTATATGTGCCAGG - Intronic
1028933569 7:96441259-96441281 TTTAATATCTATTATGTGCCAGG + Intergenic
1029794884 7:102883248-102883270 TTGATTATCTAGTATGTGCCAGG - Intronic
1030336375 7:108331622-108331644 CATAGCATCTGCTATGTGCCAGG - Intronic
1030595763 7:111537065-111537087 CTGAATATCTGCTAAGTGCCAGG + Intronic
1030987982 7:116264527-116264549 TTTATTATCTGCTATGTGTCAGG + Intergenic
1031071037 7:117162191-117162213 CTGATTATCTTTTATGTGACAGG + Intronic
1031323558 7:120364073-120364095 CTGAGTATCTCTTATGTGCCAGG - Intronic
1031364136 7:120883776-120883798 GTTATTATCTGAAAGCTGCCTGG + Intergenic
1031590328 7:123582822-123582844 TTTATTAGCTACTATGTGCCTGG - Intronic
1031814718 7:126419515-126419537 CTTTTTATCTGATATATTCCTGG + Intergenic
1033790163 7:144782952-144782974 CTGAGTATCTGTTGTGTGCCAGG - Intronic
1035536788 8:397607-397629 TTTAGTGTCTGCTATGTGCCTGG + Intergenic
1037485073 8:19339441-19339463 CTAAATATCTGATATGTGTTTGG - Intronic
1038241805 8:25816906-25816928 CTTATTTTCTGCTTTTTGCCTGG + Intergenic
1038346153 8:26734353-26734375 ATTTTTATCTGATATGGGGCTGG + Intergenic
1038467050 8:27774028-27774050 CTTAACACCTGCTATGTGCCAGG - Intronic
1038560558 8:28575416-28575438 CTGATTATCTACTATGTGCCAGG + Intergenic
1040856136 8:51949903-51949925 CTTATTATTTGCTGTGTGCATGG + Intergenic
1042982927 8:74550674-74550696 CTTAATATGTGAGAAGTGCCAGG - Intergenic
1043787214 8:84418361-84418383 CTGAGTACCTAATATGTGCCAGG - Intronic
1045753610 8:105515355-105515377 TTTATTGTGTGCTATGTGCCAGG + Intronic
1045865058 8:106855498-106855520 ATCATTATCTGATATGTGGGAGG + Intergenic
1046046254 8:108968495-108968517 CCTACTATCTACTATGTGCCAGG - Intergenic
1046710661 8:117507436-117507458 TTTAATACCTAATATGTGCCAGG - Intergenic
1046815976 8:118583948-118583970 CTTAATGTCTCTTATGTGCCAGG - Intronic
1046844274 8:118898689-118898711 TTTAGTATCTGTTATGTGCCTGG - Intergenic
1047255476 8:123210445-123210467 CTTAGCATCTCTTATGTGCCAGG + Intergenic
1047302416 8:123625036-123625058 CTTAGCACCTGTTATGTGCCAGG - Intergenic
1048141269 8:131797015-131797037 CTGAATAACTGCTATGTGCCAGG + Intergenic
1048382814 8:133883106-133883128 CTCTTTATCTGGTATGTGCCTGG + Intergenic
1050154180 9:2648475-2648497 CTTAGTGTCTGATTTGTACCAGG - Intronic
1050657896 9:7848932-7848954 CTTATTACCTGATTTTAGCCAGG - Intronic
1051410931 9:16788722-16788744 CTTATCCTCTGATCTTTGCCAGG - Intronic
1051624454 9:19085449-19085471 TTGATCATCTGATATGTGCTAGG - Intronic
1053518144 9:38749495-38749517 TTTATTATCTGATATTGGCATGG + Intergenic
1053675169 9:40418256-40418278 ATTATTATGTGATATGTGTAAGG - Intergenic
1053924956 9:43044597-43044619 ATTATTATGTGATATGTGTAAGG - Intergenic
1054288447 9:63256788-63256810 ATTATTATGTGATATGTGTAAGG - Intergenic
1054386268 9:64558324-64558346 ATTATTATGTGATATGTGTAAGG - Intergenic
1054509451 9:65958037-65958059 ATTATTATGTGATATGTGTAAGG + Intergenic
1054708601 9:68488028-68488050 GTTATCATTTGTTATGTGCCAGG - Intronic
1055713755 9:79094407-79094429 CTCATTATCTGATATCACCCTGG - Intergenic
1055964197 9:81849625-81849647 TTCAGTATCTAATATGTGCCAGG + Intergenic
1056162299 9:83909023-83909045 TTTAGTATCTACTATGTGCCAGG + Intronic
1056339518 9:85611974-85611996 CTTATTATTTCATATTTGGCTGG - Intronic
1056358043 9:85822491-85822513 TTTAGTATCTACTATGTGCCAGG - Intergenic
1057888341 9:98848465-98848487 CTGATTCTCTGATGTGTGACAGG + Intronic
1058015898 9:100031646-100031668 CTTATTATCTGACTTTAGCCAGG - Intronic
1058459439 9:105169431-105169453 CTGAGTATTTCATATGTGCCAGG + Intergenic
1058794488 9:108484594-108484616 CTTATTACCTGGTATAAGCCAGG - Intergenic
1059756657 9:117300145-117300167 CTGACTATCTGAAATGTGCCAGG + Intronic
1060476064 9:123987685-123987707 CTGAGCATCTGCTATGTGCCAGG - Intergenic
1188261247 X:28026798-28026820 CTGAGCACCTGATATGTGCCAGG + Intergenic
1188963743 X:36525395-36525417 TTTATTTTCTCATATATGCCTGG - Intergenic
1190030209 X:46965080-46965102 CTTATTGTCTGATCTGTTTCTGG - Intronic
1190591815 X:52010520-52010542 CTTATTATCAGATTTTAGCCAGG - Intergenic
1192714384 X:73624422-73624444 CTTATTACCTGACATTAGCCAGG + Intronic
1193857670 X:86625343-86625365 GTCATTATCTGATATATGCAAGG - Intronic
1194236821 X:91395081-91395103 CTGATTATCTGATATGTTAAGGG - Intergenic
1194464655 X:94218380-94218402 CTTACTGTCTCATATGTGGCAGG + Intergenic
1196217328 X:113069269-113069291 CTTTTTATTTTTTATGTGCCTGG + Intergenic
1197693733 X:129529001-129529023 CTGAGTATCTGTTATATGCCGGG - Intergenic
1197749669 X:129955967-129955989 TTTATTGTCTTCTATGTGCCGGG + Intergenic
1198282023 X:135151782-135151804 TTTCTTATCTGATGTGTTCCGGG - Intergenic
1198284324 X:135174769-135174791 TTTCTTATCTGATGTGTTCCGGG - Intergenic
1198286713 X:135198245-135198267 TTTCTTATCTGATGTGTTCCGGG - Intergenic
1198288936 X:135220740-135220762 TTTCTTATCTGATGTGTTCCGGG + Intergenic
1199431517 X:147766153-147766175 CTGAATATCTACTATGTGCCTGG + Intergenic
1199676253 X:150191665-150191687 TTTATTATCTACTATCTGCCAGG + Intergenic
1199773320 X:150989194-150989216 CAAATAATGTGATATGTGCCAGG - Exonic