ID: 912853009

View in Genome Browser
Species Human (GRCh38)
Location 1:113143341-113143363
Sequence GAATAGGGAGTAGCCCCAGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
912853002_912853009 25 Left 912853002 1:113143293-113143315 CCAGAGGCAAGTGCTGTAATTCA No data
Right 912853009 1:113143341-113143363 GAATAGGGAGTAGCCCCAGGAGG No data
912853004_912853009 2 Left 912853004 1:113143316-113143338 CCAACAATGTCTGTCACAGGTGC No data
Right 912853009 1:113143341-113143363 GAATAGGGAGTAGCCCCAGGAGG No data
912853001_912853009 26 Left 912853001 1:113143292-113143314 CCCAGAGGCAAGTGCTGTAATTC No data
Right 912853009 1:113143341-113143363 GAATAGGGAGTAGCCCCAGGAGG No data
912853000_912853009 27 Left 912853000 1:113143291-113143313 CCCCAGAGGCAAGTGCTGTAATT No data
Right 912853009 1:113143341-113143363 GAATAGGGAGTAGCCCCAGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
912853009 Original CRISPR GAATAGGGAGTAGCCCCAGG AGG Intergenic
No off target data available for this crispr