ID: 912861517

View in Genome Browser
Species Human (GRCh38)
Location 1:113218063-113218085
Sequence GGCTAGCACCATTGTGGGCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
912861517_912861525 19 Left 912861517 1:113218063-113218085 CCCTGCCCACAATGGTGCTAGCC No data
Right 912861525 1:113218105-113218127 ACCCAGGAAGCAAGTCACATGGG No data
912861517_912861524 18 Left 912861517 1:113218063-113218085 CCCTGCCCACAATGGTGCTAGCC No data
Right 912861524 1:113218104-113218126 GACCCAGGAAGCAAGTCACATGG No data
912861517_912861523 3 Left 912861517 1:113218063-113218085 CCCTGCCCACAATGGTGCTAGCC No data
Right 912861523 1:113218089-113218111 CCACTTGATAGATAAGACCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
912861517 Original CRISPR GGCTAGCACCATTGTGGGCA GGG (reversed) Intergenic
No off target data available for this crispr