ID: 912863155

View in Genome Browser
Species Human (GRCh38)
Location 1:113232763-113232785
Sequence GCCCCCAGTACCACCCTGTA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
912863147_912863155 29 Left 912863147 1:113232711-113232733 CCCAGCGCACAAAGGGAGGGCCC No data
Right 912863155 1:113232763-113232785 GCCCCCAGTACCACCCTGTATGG No data
912863152_912863155 8 Left 912863152 1:113232732-113232754 CCAGATTAAGATGCACGGGAGCC No data
Right 912863155 1:113232763-113232785 GCCCCCAGTACCACCCTGTATGG No data
912863148_912863155 28 Left 912863148 1:113232712-113232734 CCAGCGCACAAAGGGAGGGCCCA No data
Right 912863155 1:113232763-113232785 GCCCCCAGTACCACCCTGTATGG No data
912863146_912863155 30 Left 912863146 1:113232710-113232732 CCCCAGCGCACAAAGGGAGGGCC No data
Right 912863155 1:113232763-113232785 GCCCCCAGTACCACCCTGTATGG No data
912863151_912863155 9 Left 912863151 1:113232731-113232753 CCCAGATTAAGATGCACGGGAGC No data
Right 912863155 1:113232763-113232785 GCCCCCAGTACCACCCTGTATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
912863155 Original CRISPR GCCCCCAGTACCACCCTGTA TGG Intergenic
No off target data available for this crispr