ID: 912865357

View in Genome Browser
Species Human (GRCh38)
Location 1:113251433-113251455
Sequence CCCCTAAGGATCCCTGTCCC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
912865350_912865357 2 Left 912865350 1:113251408-113251430 CCTCCCATGCTCAGCCAGTCATA No data
Right 912865357 1:113251433-113251455 CCCCTAAGGATCCCTGTCCCTGG No data
912865349_912865357 22 Left 912865349 1:113251388-113251410 CCTCAACGTCTCTCTTCTCTCCT No data
Right 912865357 1:113251433-113251455 CCCCTAAGGATCCCTGTCCCTGG No data
912865352_912865357 -2 Left 912865352 1:113251412-113251434 CCATGCTCAGCCAGTCATAACCC No data
Right 912865357 1:113251433-113251455 CCCCTAAGGATCCCTGTCCCTGG No data
912865351_912865357 -1 Left 912865351 1:113251411-113251433 CCCATGCTCAGCCAGTCATAACC No data
Right 912865357 1:113251433-113251455 CCCCTAAGGATCCCTGTCCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
912865357 Original CRISPR CCCCTAAGGATCCCTGTCCC TGG Intergenic
No off target data available for this crispr