ID: 912867091

View in Genome Browser
Species Human (GRCh38)
Location 1:113267279-113267301
Sequence GAGTATCCCTGTGCCCAAGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
912867091_912867096 12 Left 912867091 1:113267279-113267301 CCCCCTTGGGCACAGGGATACTC No data
Right 912867096 1:113267314-113267336 CTTCATAGATGCCCCCACACTGG No data
912867091_912867097 13 Left 912867091 1:113267279-113267301 CCCCCTTGGGCACAGGGATACTC No data
Right 912867097 1:113267315-113267337 TTCATAGATGCCCCCACACTGGG No data
912867091_912867104 28 Left 912867091 1:113267279-113267301 CCCCCTTGGGCACAGGGATACTC No data
Right 912867104 1:113267330-113267352 ACACTGGGATTTGGCCCGCAGGG No data
912867091_912867098 19 Left 912867091 1:113267279-113267301 CCCCCTTGGGCACAGGGATACTC No data
Right 912867098 1:113267321-113267343 GATGCCCCCACACTGGGATTTGG No data
912867091_912867103 27 Left 912867091 1:113267279-113267301 CCCCCTTGGGCACAGGGATACTC No data
Right 912867103 1:113267329-113267351 CACACTGGGATTTGGCCCGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
912867091 Original CRISPR GAGTATCCCTGTGCCCAAGG GGG (reversed) Intergenic
No off target data available for this crispr