ID: 912867873

View in Genome Browser
Species Human (GRCh38)
Location 1:113275231-113275253
Sequence CCAGTTCCTGCTCATTCTTT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
912867873_912867881 13 Left 912867873 1:113275231-113275253 CCCAAAGAATGAGCAGGAACTGG No data
Right 912867881 1:113275267-113275289 TGGGAGAGGAAGTCCCAGGCAGG No data
912867873_912867880 9 Left 912867873 1:113275231-113275253 CCCAAAGAATGAGCAGGAACTGG No data
Right 912867880 1:113275263-113275285 GAGGTGGGAGAGGAAGTCCCAGG No data
912867873_912867879 -1 Left 912867873 1:113275231-113275253 CCCAAAGAATGAGCAGGAACTGG No data
Right 912867879 1:113275253-113275275 GCTAAGTGCAGAGGTGGGAGAGG No data
912867873_912867876 -10 Left 912867873 1:113275231-113275253 CCCAAAGAATGAGCAGGAACTGG No data
Right 912867876 1:113275244-113275266 CAGGAACTGGCTAAGTGCAGAGG No data
912867873_912867882 16 Left 912867873 1:113275231-113275253 CCCAAAGAATGAGCAGGAACTGG No data
Right 912867882 1:113275270-113275292 GAGAGGAAGTCCCAGGCAGGAGG No data
912867873_912867877 -7 Left 912867873 1:113275231-113275253 CCCAAAGAATGAGCAGGAACTGG No data
Right 912867877 1:113275247-113275269 GAACTGGCTAAGTGCAGAGGTGG No data
912867873_912867878 -6 Left 912867873 1:113275231-113275253 CCCAAAGAATGAGCAGGAACTGG No data
Right 912867878 1:113275248-113275270 AACTGGCTAAGTGCAGAGGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
912867873 Original CRISPR CCAGTTCCTGCTCATTCTTT GGG (reversed) Intergenic
No off target data available for this crispr