ID: 912869033

View in Genome Browser
Species Human (GRCh38)
Location 1:113286395-113286417
Sequence GATCCCAGTATAATCCAAGT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
912869033_912869037 23 Left 912869033 1:113286395-113286417 CCTACTTGGATTATACTGGGATC No data
Right 912869037 1:113286441-113286463 CTGCTGAGCCTAGCATATCTGGG No data
912869033_912869036 22 Left 912869033 1:113286395-113286417 CCTACTTGGATTATACTGGGATC No data
Right 912869036 1:113286440-113286462 GCTGCTGAGCCTAGCATATCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
912869033 Original CRISPR GATCCCAGTATAATCCAAGT AGG (reversed) Intergenic
No off target data available for this crispr