ID: 912869034

View in Genome Browser
Species Human (GRCh38)
Location 1:113286417-113286439
Sequence TACTTCACTGAGAAACATAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
912869034_912869036 0 Left 912869034 1:113286417-113286439 CCCTTATGTTTCTCAGTGAAGTA No data
Right 912869036 1:113286440-113286462 GCTGCTGAGCCTAGCATATCTGG No data
912869034_912869037 1 Left 912869034 1:113286417-113286439 CCCTTATGTTTCTCAGTGAAGTA No data
Right 912869037 1:113286441-113286463 CTGCTGAGCCTAGCATATCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
912869034 Original CRISPR TACTTCACTGAGAAACATAA GGG (reversed) Intergenic
No off target data available for this crispr