ID: 912869034 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 1:113286417-113286439 |
Sequence | TACTTCACTGAGAAACATAA GGG (reversed) |
Strand | - |
Crispr in exon? | No |
Crispr in intron? | No |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | ||||
Summary |
Found 2 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
912869034_912869037 | 1 | Left | 912869034 | 1:113286417-113286439 | CCCTTATGTTTCTCAGTGAAGTA | No data | ||
Right | 912869037 | 1:113286441-113286463 | CTGCTGAGCCTAGCATATCTGGG | No data | ||||
912869034_912869036 | 0 | Left | 912869034 | 1:113286417-113286439 | CCCTTATGTTTCTCAGTGAAGTA | No data | ||
Right | 912869036 | 1:113286440-113286462 | GCTGCTGAGCCTAGCATATCTGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
912869034 | Original CRISPR | TACTTCACTGAGAAACATAA GGG (reversed) | Intergenic | ||