ID: 912869037

View in Genome Browser
Species Human (GRCh38)
Location 1:113286441-113286463
Sequence CTGCTGAGCCTAGCATATCT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
912869034_912869037 1 Left 912869034 1:113286417-113286439 CCCTTATGTTTCTCAGTGAAGTA No data
Right 912869037 1:113286441-113286463 CTGCTGAGCCTAGCATATCTGGG No data
912869035_912869037 0 Left 912869035 1:113286418-113286440 CCTTATGTTTCTCAGTGAAGTAG No data
Right 912869037 1:113286441-113286463 CTGCTGAGCCTAGCATATCTGGG No data
912869033_912869037 23 Left 912869033 1:113286395-113286417 CCTACTTGGATTATACTGGGATC No data
Right 912869037 1:113286441-113286463 CTGCTGAGCCTAGCATATCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
912869037 Original CRISPR CTGCTGAGCCTAGCATATCT GGG Intergenic
No off target data available for this crispr