ID: 912871407

View in Genome Browser
Species Human (GRCh38)
Location 1:113310480-113310502
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
912871395_912871407 14 Left 912871395 1:113310443-113310465 CCTCATGGCACAGGGAGAAAATC No data
Right 912871407 1:113310480-113310502 AGGGAGAGCACAGGGATTGTGGG No data
912871391_912871407 26 Left 912871391 1:113310431-113310453 CCCTGGCAGCAGCCTCATGGCAC No data
Right 912871407 1:113310480-113310502 AGGGAGAGCACAGGGATTGTGGG No data
912871390_912871407 27 Left 912871390 1:113310430-113310452 CCCCTGGCAGCAGCCTCATGGCA No data
Right 912871407 1:113310480-113310502 AGGGAGAGCACAGGGATTGTGGG No data
912871392_912871407 25 Left 912871392 1:113310432-113310454 CCTGGCAGCAGCCTCATGGCACA No data
Right 912871407 1:113310480-113310502 AGGGAGAGCACAGGGATTGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type