ID: 912873241

View in Genome Browser
Species Human (GRCh38)
Location 1:113328863-113328885
Sequence AGGGAGAATGCAGTAATTGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
912873241_912873250 30 Left 912873241 1:113328863-113328885 CCCACAATTACTGCATTCTCCCT No data
Right 912873250 1:113328916-113328938 CCATTTGGCCATCCATTGCCAGG No data
912873241_912873247 15 Left 912873241 1:113328863-113328885 CCCACAATTACTGCATTCTCCCT No data
Right 912873247 1:113328901-113328923 AATTCTCTCACCATGCCATTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
912873241 Original CRISPR AGGGAGAATGCAGTAATTGT GGG (reversed) Intergenic
No off target data available for this crispr