ID: 912873242

View in Genome Browser
Species Human (GRCh38)
Location 1:113328864-113328886
Sequence GAGGGAGAATGCAGTAATTG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
912873242_912873251 30 Left 912873242 1:113328864-113328886 CCACAATTACTGCATTCTCCCTC No data
Right 912873251 1:113328917-113328939 CATTTGGCCATCCATTGCCAGGG No data
912873242_912873250 29 Left 912873242 1:113328864-113328886 CCACAATTACTGCATTCTCCCTC No data
Right 912873250 1:113328916-113328938 CCATTTGGCCATCCATTGCCAGG No data
912873242_912873247 14 Left 912873242 1:113328864-113328886 CCACAATTACTGCATTCTCCCTC No data
Right 912873247 1:113328901-113328923 AATTCTCTCACCATGCCATTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
912873242 Original CRISPR GAGGGAGAATGCAGTAATTG TGG (reversed) Intergenic
No off target data available for this crispr